Recombinant escherichia coli and construction method and application thereof

A technology for recombining Escherichia coli and Escherichia coli, which is applied in the direction of recombinant DNA technology, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem that Escherichia coli cannot directly use electrons to synthesize succinic acid, etc., and achieve an increase in quality and yield , the effect of enhancing the restoring power

Active Publication Date: 2019-02-22
NANJING UNIV OF TECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Purpose of the invention: In order to solve the problem that the existing Escherichia coli cannot directly use electrons to synthesize succinic acid, the present invention provides a recombinant Escherichia coli, further provides a construction method of the Escherichia coli, and further provides the Escherichia coli Application of Bacillus in Electrosynthesis of Succinic Acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli and construction method and application thereof
  • Recombinant escherichia coli and construction method and application thereof
  • Recombinant escherichia coli and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037](1) Using the phenazine-1-carboxylic acid synthesis gene phzA1B1C1D1E1F1G1 (its nucleotide sequence as shown in SEQ ID No: 1) of Pseudomonas aeruginosa (Pseudomonas aeruginosa) PAO1 as a template, the target gene was obtained by PCR amplification phz, Pseudomonas aeruginosa PAO1 is recorded in Chinese patent ZL2013100341088;

[0038] The primers are as follows:

[0039] phzA-1: GGGGTACCATGAACGGTCAGCGGTACAGG

[0040] phzG-1:TGCTCTAGATCACGGTTGCAGGTAGCGGTG;

[0041] The PCR amplification system and amplification conditions are shown in Table 1:

[0042] Table 1 Gene phzPCR amplification system and amplification conditions

[0043]

[0044] (2) Cloning the target gene phz obtained in step (1) to the ptrc99a plasmid to obtain the recombinant plasmid ptrc99a-phz, such as figure 1 Shown; wherein the enzyme digestion system of the ptrc99a plasmid and the target gene phz obtained in step (1) are shown in Table 2 and Table 3, and the enzyme linkage system of the recombinant...

Embodiment 2

[0066] The construction method of the recombinant Escherichia coli is the same as in Example 1, except that the phenazine-1-carboxylic acid synthesis gene is phzA2B2C2D2E2F2G2 (its nucleotide sequence is shown in SEQ ID No: 2).

Embodiment 3

[0068] A single colony of E.coli-phz obtained in Example 1 was picked and inoculated into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and the strain was activated overnight at 37° C. and 200 rpm. The activated bacterial species was transferred to 50mL LB liquid medium (the liquid medium of the recombinant strain contained 100 μg / mL ampicillin) according to the inoculum amount of 1% (v / v), and cultivated to OD at 37°C and 200rpm 600 About 0.5; add IPTG to a final concentration of 0.5mM, induce culture at 30°C, 200rpm for 12h. After the cultured bacterial liquid was centrifuged at 4000×g, the supernatant was extracted with chloroform and placed outdoors. After the chloroform evaporated to dryness, it was dissolved in acetonitrile to determine the PCA content. The original strain E.coli K12 (ΔldhA, ΔpflB, ΔptsG) was used as the control.

[0069] Among them, the formula of LB liquid medium is as follows: 10g / L peptone; 5g / L yeast powder; 5g / L NaCl.

[0070] Wherein...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant escherichia coli in which a phenazine-1-carboxylic acid synthetic gene is introduced and also discloses a construction method of the recombinant escherichia coli and application of the recombinant escherichia coli in succinic acid preparation. The succinic acid yield and conversion rate of the recombinant strain E. coli-phz are obviously higher than those of anoriginal strain E.coli K12(DeltaldhA, DeltapflB, DeltaptsG), fumaric acid is used as a carbon source, and compared with the original strain E.coli K12(DeltaldhA, DeltapflB, DeltaptsG), the succinic acid yield of the recombinant strain E. coli-phz is improved by 68%. Glucose is used as a carbon source, and compared with the original strain E.coli K12(DeltaldhA, DeltapflB, DeltaptsG), the mass yieldof the recombinant strain E. coli-phz is improved by 26%.

Description

technical field [0001] The invention relates to the electrochemical synthesis of succinic acid by Escherichia coli, in particular to a recombinant Escherichia coli and its construction method and application. Background technique [0002] A bioelectrochemical system is an electrochemical system in which biocatalysts perform oxidation and / or reduction reactions on electrodes. Microbial Electrochemical systems (MECs) are formed when microorganisms are used as catalysts. The microbial electrochemical system is constructed on the basis of microbial electrochemical technology in recent years. It is a comprehensive subject process system that integrates biology, chemistry, physics, electromagnetics and other disciplines, and has gradually become a research area in the field of modern energy and environment. hot spot. [0003] In the bioelectrochemical system, microbial electrosynthesis is a new technology developed in recent years. It mainly transfers electrode electrons into mic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/46C12R1/19
CPCC12N15/70C12P7/46C07K14/21
Inventor陈可泉冯娇李康许晟王昕欧阳平凯
OwnerNANJING UNIV OF TECH