Recombinant escherichia coli and construction method and application thereof
A technology for recombining Escherichia coli and Escherichia coli, which is applied in the direction of recombinant DNA technology, microorganism-based methods, biochemical equipment and methods, etc., can solve the problem that Escherichia coli cannot directly use electrons to synthesize succinic acid, etc., and achieve an increase in quality and yield , the effect of enhancing the restoring power
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037](1) Using the phenazine-1-carboxylic acid synthesis gene phzA1B1C1D1E1F1G1 (its nucleotide sequence as shown in SEQ ID No: 1) of Pseudomonas aeruginosa (Pseudomonas aeruginosa) PAO1 as a template, the target gene was obtained by PCR amplification phz, Pseudomonas aeruginosa PAO1 is recorded in Chinese patent ZL2013100341088;
[0038] The primers are as follows:
[0039] phzA-1: GGGGTACCATGAACGGTCAGCGGTACAGG
[0040] phzG-1:TGCTCTAGATCACGGTTGCAGGTAGCGGTG;
[0041] The PCR amplification system and amplification conditions are shown in Table 1:
[0042] Table 1 Gene phzPCR amplification system and amplification conditions
[0043]
[0044] (2) Cloning the target gene phz obtained in step (1) to the ptrc99a plasmid to obtain the recombinant plasmid ptrc99a-phz, such as figure 1 Shown; wherein the enzyme digestion system of the ptrc99a plasmid and the target gene phz obtained in step (1) are shown in Table 2 and Table 3, and the enzyme linkage system of the recombinant...
Embodiment 2
[0066] The construction method of the recombinant Escherichia coli is the same as in Example 1, except that the phenazine-1-carboxylic acid synthesis gene is phzA2B2C2D2E2F2G2 (its nucleotide sequence is shown in SEQ ID No: 2).
Embodiment 3
[0068] A single colony of E.coli-phz obtained in Example 1 was picked and inoculated into 5 mL of LB liquid medium containing 100 μg / mL ampicillin, and the strain was activated overnight at 37° C. and 200 rpm. The activated bacterial species was transferred to 50mL LB liquid medium (the liquid medium of the recombinant strain contained 100 μg / mL ampicillin) according to the inoculum amount of 1% (v / v), and cultivated to OD at 37°C and 200rpm 600 About 0.5; add IPTG to a final concentration of 0.5mM, induce culture at 30°C, 200rpm for 12h. After the cultured bacterial liquid was centrifuged at 4000×g, the supernatant was extracted with chloroform and placed outdoors. After the chloroform evaporated to dryness, it was dissolved in acetonitrile to determine the PCA content. The original strain E.coli K12 (ΔldhA, ΔpflB, ΔptsG) was used as the control.
[0069] Among them, the formula of LB liquid medium is as follows: 10g / L peptone; 5g / L yeast powder; 5g / L NaCl.
[0070] Wherein...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com