Glucose oxidase mutant

A technology of glucose oxidase and mutants, applied in the directions of oxidoreductase, enzymes, biochemical equipment and methods, etc., can solve the problems of affecting the application effect of glucose oxidase, inactivation of glucose oxidase, etc.

Active Publication Date: 2019-03-05
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] However, the short-term high temperature process in the process of feed processing will cause the inactivation of glucose oxidase, which will affect the application effect of glucose oxidase. On the premise that the production of glucose oxidase is guaranteed, the temperature resistance of glucose oxidase has become increasingly popular. Concern, therefore, it is imminent to develop glucose oxidase with strong temperature resistance by genetic engineering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucose oxidase mutant
  • Glucose oxidase mutant
  • Glucose oxidase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Obtaining of Glucose Oxidase Thermostable Mutant

[0042] 1.1 Amplification of the glucose oxidase gene

[0043] The Aspergillus niger genome was used as a template for PCR amplification, and the PCR primers GOD-F1 and GOD-R1 were as follows:

[0044] GOD-F1: GGTATTGAGGCATCTTTGTTGAC;

[0045] GOD-R1: TTATTGCATAGAAGCGTAATC;

[0046] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the glucose oxidase from Aspergillus niger was as high as 100%, so it was confirmed that the gene obtained by PCR was the glucose oxidase gene, named as the starting enzyme GOD.

[0047] 1.2 Amplification and synt...

Embodiment 2

[0097] Example 2 Screening of Glucose Oxidase Thermostable Mutation Combination

[0098] In order to improve the heat resistance of glucose oxidase GOD, the applicant conducted a mutation combination study on the 65th, 275th and 416th amino acid sites obtained by screening, the 65th amino acid was changed from A to R, and the 275th amino acid From H to F, the 416th amino acid is changed from A to K; the mutant obtained in this way is called GOD-K, and its amino acid sequence is SEQ ID NO:5, and a kind of coding nucleotide sequence thereof is SEQ ID NO: 6. The residual enzyme activity of mutant GOD-K was 68.20% after treatment at 70°C for 2.5 minutes, and 42.76% after treatment at 75°C for 2.5 minutes, and the heat resistance was significantly improved.

[0099] In order to improve the heat resistance of the above-mentioned three-point mutant GOD-K (A65R, H275F and A416K), the applicant further introduced any one or two of the five heat-resistant mutation sites of T32L, V104I,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention aims to provide a heat-resistant glucose oxidase mutant. Remained enzyme activity is 29.02% and remarkably higher than that of a wild type after the glucose oxidase mutant containing V104I single-site mutation is processed for 2.5 minutes at the temperature of 70 DEG C. In order to further improve heat resistance of a glucose oxidase three-point mutant GOD-K (A65R, H275F and A416K),V104I single-site mutation and combination of mutation sites of V104I and T32L and/or A290L are introduced, and results display that the heat resistance of an acquired mutant is remarkably higher thanthat of the GOD-K, and the remaining enzymatic activity of the mutant reaches up to 83.10% after acquired mutant is processed for 2.5 minutes at the temperature of 75 DEG C and is improved by 46.42%as compared with that of the GOD-K, so that the mutant is more suitable for the field of feed processing.

Description

technical field [0001] The invention belongs to the technical field of genetic modification, and in particular relates to a glucose oxidase mutant and application thereof. Background technique [0002] Glucose oxidase (glucose oxidase, E.C.1.1.3.4, GOD) can specifically catalyze β-D-glucose to generate gluconic acid and hydrogen peroxide under aerobic conditions. Glucose oxidase is a homodimeric molecule containing two flavin adenine dinucleotide (FAD) binding sites. Each monomer contains two completely different domains: one is non-covalently but tightly bound to part of FAD, mainly for acoustic folding; the other binds to the substrate β-D-glucose, and is supported by 4 α-helices for a trans Parallel beta-sheets. [0003] Glucose oxidase is widely distributed in animals, plants and microorganisms. However, the content of glucose oxidase in animal and plant tissues is limited, and microorganisms are widely used as the source of glucose oxidase because of their advantages...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/04C12N15/53C12N15/63
CPCA23K20/189C12N9/0006C12Y101/03004
Inventor 吴秀秀邵弨黄亦钧
Owner QINGDAO VLAND BIOTECH GRP
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap