Glucose oxidase mutant
A technology of glucose oxidase and mutants, applied in the directions of oxidoreductase, enzymes, biochemical equipment and methods, etc., can solve the problems of affecting the application effect of glucose oxidase, inactivation of glucose oxidase, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Example 1 Obtaining of Glucose Oxidase Thermostable Mutant
[0042] 1.1 Amplification of the glucose oxidase gene
[0043] The Aspergillus niger genome was used as a template for PCR amplification, and the PCR primers GOD-F1 and GOD-R1 were as follows:
[0044] GOD-F1: GGTATTGAGGCATCTTTGTTGAC;
[0045] GOD-R1: TTATTGCATAGAAGCGTAATC;
[0046] The PCR product was recovered by gel, connected to the pEASY-T vector, transformed into Escherichia coli DH5α, and the correct transformant was picked for sequencing. Sequencing results showed that the nucleotide sequence of the amplified gene fragment was SEQ ID NO: 2, and the encoded amino acid sequence was SEQ ID NO: 1. Through NCBI BLAST comparison, it was found that the sequence similarity between SEQ ID NO: 1 and the glucose oxidase from Aspergillus niger was as high as 100%, so it was confirmed that the gene obtained by PCR was the glucose oxidase gene, named as the starting enzyme GOD.
[0047] 1.2 Amplification and synt...
Embodiment 2
[0097] Example 2 Screening of Glucose Oxidase Thermostable Mutation Combination
[0098] In order to improve the heat resistance of glucose oxidase GOD, the applicant conducted a mutation combination study on the 65th, 275th and 416th amino acid sites obtained by screening, the 65th amino acid was changed from A to R, and the 275th amino acid From H to F, the 416th amino acid is changed from A to K; the mutant obtained in this way is called GOD-K, and its amino acid sequence is SEQ ID NO:5, and a kind of coding nucleotide sequence thereof is SEQ ID NO: 6. The residual enzyme activity of mutant GOD-K was 68.20% after treatment at 70°C for 2.5 minutes, and 42.76% after treatment at 75°C for 2.5 minutes, and the heat resistance was significantly improved.
[0099] In order to improve the heat resistance of the above-mentioned three-point mutant GOD-K (A65R, H275F and A416K), the applicant further introduced any one or two of the five heat-resistant mutation sites of T32L, V104I,...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


