Unlock instant, AI-driven research and patent intelligence for your innovation.

sgRNA (small guideRibonucleic Acid) for C5aR1 gene knockout, vector, construction method and detection method

A gene knockout, gene knockout mouse technology, applied in the direction of DNA / RNA fragments, the use of vectors to introduce foreign genetic material, and other methods of inserting foreign genetic material, can solve problems such as rarely mentioned effects, and achieve the method easy effect

Active Publication Date: 2019-03-08
PEKING UNIV THIRD HOSPITAL
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Anaphylatoxin C5a (Complement component 5a, C5a) is a member of the complement system. A large number of evidences have confirmed that C5a plays a very important role in acute inflammatory response, but its role in chronic inflammatory response is rarely mentioned

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • sgRNA (small guideRibonucleic Acid) for C5aR1 gene knockout, vector, construction method and detection method
  • sgRNA (small guideRibonucleic Acid) for C5aR1 gene knockout, vector, construction method and detection method
  • sgRNA (small guideRibonucleic Acid) for C5aR1 gene knockout, vector, construction method and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Design of EGE-WFZ-004 Gene Knockout Model Mice

[0045] 1. Understanding of relevant information and design of shooting strategies

[0046] The EGE-WFZ-004 gene is on the reverse strand of chromosome 7, with a total length of about 12.59kb. Gene ID: 12273. The EGE-WFZ-004 gene has 3 transcripts.

[0047] The gene structure of EGE-WFZ-004 was analyzed, and the entire coding region was selected to be deleted. The sgRNAs were designed in the non-conserved regions downstream of Intron1-2 and 3'UTR respectively, resulting in about 5.5kb genome deletion, so as to achieve the purpose of EGE-WFZ-004 gene knockout. Model mice were prepared using the EGE system developed by Biocytogen based on CRISPR / Cas9. Specific knockout strategies such as figure 1 shown.

[0048]2. Preparation of EGE-WFZ-004 gene knockout model mice

[0049] 2.1 Sequencing confirmation of target sequence

[0050] Different strains may have different target gene sequences. In order to ensure the effic...

Embodiment 2

[0072] The EGE-WFZ-004-sgRNA4 and EGE-WFZ-004-sgRNA13 obtained in Example 1 are designed to be connected to the sequence for in vitro transcription on the plasmid vector with a T7 promoter, as follows:

[0073] EGE-WFZ-004-T7-sgRNA4:

[0074] CTATTTCTAGCTCTAAAACCAGATATCGGTCACAGTTCCTATAGTGAGT CGTATTA;

[0075] EGE-WFZ-004-T7-sgRNA13:

[0076] CTATTTCTAGCTCTAAAACAATGATTTGTAATGGCTGCCTATAGTGAGT CGTATTA.

[0077] EGE-WFZ-004-T7-sgRNA4 and EGE-WFZ-004-T7-sgRNA13 were respectively connected to the plasmid vector with T7 promoter for transcription, and the obtained RNA was as follows: image 3 shown. The resulting RNA was used for microinjection.

[0078] 1. Microinjection of Cas9 / sgRNA

[0079] Cas9 / sgRNA were microinjected into mouse (C57BL / 6N) fertilized eggs respectively, a total of 332 were injected, and 45 F0 mice were born after injection.

[0080] 2. Genotype detection of F0 generation mice

[0081] Identify primers designed as Figure 4 shown. Figure 4 In , arrows r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of gene knockout, particularly to a sgRNA (small guideRibonucleic Acid) for C5aR1 gene knockout, a vector, a construction method and a detection method. The sgRNA for C5aR1 gene knockout is characterized in that the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.1 and SEQ ID NO.2. By analysis of to-be-knocked-out sequences, 14 sgRNAs are involved in total; through activity detection, two sgRNAs are obtained; and through subsequent experimental verifications, the two sgRNAs are matched with Cas9 proteins to obtain a C5aR1 gene knockout mouse.

Description

technical field [0001] The present invention relates to the field of gene knockout, in particular to sgRNA, vector, construction method and detection method for C5aR1 gene knockout. Background technique [0002] Chronic Obstructive Pulmonary Disease (COPD) is a chronic airway inflammatory disease, and airway wall remodeling is one of its main pathological features and an important reason for the refractory disease progression. The development of COPD is associated with an enhanced chronic inflammatory response of the airways and lungs to noxious gases or particles. [0003] Currently, airway remodeling is believed to be not only the abnormal repair process based on airway inflammation, but also related to mechanisms such as oxidative damage, protease-antiprotease imbalance, apoptosis and abnormal clearance of apoptotic cells. Although inhaled glucocorticoids are used clinically to treat airway inflammation, the therapeutic effect is still unsatisfactory, suggesting that the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/85C12N15/90A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/0368C12N15/113C12N15/8509C12N15/907C12N2310/10C12N2310/20C12N2810/10
Inventor 张静徐昕晔路明
Owner PEKING UNIV THIRD HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com