A method for the production of colaric acid by acid-resistant high-density Escherichia coli

A technology of Escherichia coli and koala acid, which is applied in the field of microorganisms, can solve the problems of low efficiency of koala acid, and achieve the effects of high yield, short fermentation time and fast cell growth

Active Publication Date: 2021-11-30
SHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Aiming at solving the problem of low efficiency of colanic acid secretion by existing Escherichia coli species

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for the production of colaric acid by acid-resistant high-density Escherichia coli
  • A method for the production of colaric acid by acid-resistant high-density Escherichia coli
  • A method for the production of colaric acid by acid-resistant high-density Escherichia coli

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Escherichia coli species Escherichia coli S17-3 Acquisition, Identification and Preservation

[0048] Escherichia coli S17-3 A model Escherichia coli used in laboratories around the world Escherichia coli The mutant strain of S17-1, the Escherichia coli has undergone ultraviolet mutagenesis in the inventor's laboratory, and long-term cultivation, both ultraviolet mutagenesis and natural random mutation may cause changes in the properties of microorganisms. The strain's culture performance changes, as well as subsequent genome sequencing and comparison, have confirmed that mutations at multiple gene sites have occurred, and were preserved in the China Center for Type Culture Collection on April 16, 2018, with the preservation number of CCTCC 2018200.

[0049] Escherichia coli species isolated by the present invention Escherichia coli S17-3, which is a short bacillus with blunt ends, about 0.5 um-3 um in size, has milky white and smooth surface round colo...

Embodiment 2

[0055] Example 2 Construction method of Escherichia coli S17-3 high-density growth system

[0056] a. Construction of recombinant plasmids pETACAB and pBhya-CAB

[0057] The map of the constructed recombinant plasmid pETACAB is as follows figure 2 shown. First, a 3870 bp fragment was excised from the plasmid pET-A stored in the laboratory by double enzyme digestion (restriction sites Nde I and Hind III) (the nucleotide sequence of the 3870 bp fragment is shown in SEQ ID NO.1, Specifically:

[0058]tatggcacgtctctcctccttgcgacaccggcaggacaccgggcgcttatggtcggcaagcgacgtccctgtagcaaggcaaaccatcgcttcacgtgagatgctgaaaacgaaagctcatccttctgcactggcgcacgtcgccagaaagtattgttaataaagcgtagtgaaacttttgcacaaaacaatacaaactgtgtggatttatcttttagcgataaaaatggacctatttttcttttggccgggcggtggggatgtttagccggttgctaaacgagtaaaagagaaggaattcggatcctagagggaaaccgttgtggtctccctatagtgagtcgtattaatttcgcgggatcgagatctcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgctcctgtcgttgaggacccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcga...

Embodiment 3

[0104] Example 3 Recombinant Escherichia coli fermented and produced colaric acid at an initial low pH value

[0105] Use recombinant Escherichia coli S17-3 / pBhya-CAB as the production strain for shake flask fermentation: pick Escherichia coli S17-3 / pBhya-CAB with an inoculation loop and inoculate it into a test tube containing 3 ml LB, at 37 °C, 200 r / overnight on a shaker. Inoculate the overnight cultured Escherichia coli into a 500 mL shake flask containing 50 mL of liquid LB medium at an inoculum size of 1%, add 20 g / L of glucose and 50 ul of 100 ug / ml of ampicillin , and also carried out fermentation culture at 37°C, 200 r / min shaker. The initial pH of the medium was controlled at pH 4.5 using 3 M hydrochloric acid. After 24 hours of fermentation, samples were taken to measure the production of coracic acid. The method for determining the production of coracic acid is as follows: firstly prepare a fucose mother liquor of 10 g / L, and dilute the mother liquor to a conce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for producing colaric acid by acid-resistant high-density Escherichia coli. The E. coli species Escherichia coli S17-3 can be used to produce colaric acid, and the specific method is: adopt Escherichia coli species Escherichia coli S17-3 as the production strain, cultivate, and collect secretions, separate and obtain Cola acid. The preservation number of the Escherichia coli S17-3 species is: CCTCC 2018200. The present invention produces for the first time a mutant strain of Escherichia coli through acid-induced fermentation at 37°C, not only has high yield, but also has fast cell growth and short fermentation time, and provides a technical method for high-efficiency production of kolamic acid.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to a method for producing colaric acid by acid-resistant high-density Escherichia coli. Background technique [0002] Microbial exopolysaccharides include bacterial polysaccharides, fungal polysaccharides, etc., which are polysaccharides synthesized by bacteria in order to adapt to environmental changes and improve their own survival probability during life activities. They all have their own unique functions and unique biological activities. In the life activities of bacteria, the capsular polysaccharide or mucus polysaccharide produced by it can not only maintain the water balance inside and outside the cell, prevent the cell from losing water, protect the cell and help it resist harmful substances. Microbial exopolysaccharides are also widely used in industry. For example, xanthan gum, gellan gum, and thermal gel have various important biological activities and physiolo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20C12R1/19
CPCC12P19/04
Inventor孙俊松吴海英纪明华段海燕凌喆史吉平李久盛
OwnerSHANGHAI ADVANCED RES INST CHINESE ACADEMY OF SCI