A kind of expression system of meningococcal fhbp protein
A meningococcal and expression system technology, applied in the field of genetic engineering, can solve the problems of easily containing heat sources and high costs, and achieve the effects of reducing production costs, simplifying production processes, and improving safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1 Cloning of fHbp antigen gene and construction of plant expression vector
[0031] The MenB standard strain MC58 was drawn on the chocolate solid medium. 37°C, 5% CO 2 Cultivate for 36-48hr. Pick a single colony with a diameter of 1.0-1.5 mm and resuspend it with PBS, and use the Universal Genomic DNA Extraction Kit to extract the whole genome of MC58. According to the known fHbp sequence, Primer Premier 5.0 was used to design two specific primers upstream and downstream of fHbp and introduced NcoI and HindIII restriction sites at the 5' and 3'. The primer sequences were:
[0032] Upstream primer: 5'ATCGT CCATGG GACATCATCATCATCATC 3';
[0033] Downstream primer: 5' AAGCTT AATTAGCCATAGAAATAGCAGC 3'.
[0034] The fHbp fragment was amplified and ligated into pEASY-T1. The vector was named pEASY-T1-fHbp.
[0035] pEASY-T1-fHbp and p1301-phas were digested by Nco I and Hind III enzymes respectively, and the digestion effect was detected by 1% agarose gel e...
Embodiment 2
[0043] Embodiment 2 plant expression vector transforms Agrobacterium
[0044] 1) Preparation of Agrobacterium EHA105 Competent Cells
[0045]Inoculate a single colony of Agrobacterium EHA105 in 5mL YEP liquid medium, and culture overnight at 28°C and 220rpm. Take 2mL of the overnight culture and transfer it to 50mL of YEP liquid medium, and cultivate it to OD at 28°C and 220rpm 600 0.5, ice bath for 30min, centrifuge at 5000rpm at 4°C for 5min, discard the supernatant, add 700μL of 50mmol / L CaCl 2 and 300 μL of 80% glycerol to resuspend the bacterial cells, aliquot 100 μL per tube, and store at -80°C.
[0046] 2) Transformation of Agrobacterium
[0047] Take 20ng of the purified plasmid pCAMBIA-fHbp, add it to 100μL Agrobacterium competent, mix well, put it in ice bath for 30min, transfer to liquid nitrogen for 5min, and quickly place it at 37℃ for 5min, add 800μL YEP liquid medium, 28℃220rpm Cultivate for 4-5h. Transfer the bacterial liquid to the solid YEP medium contai...
Embodiment 3
[0050] Example 3 Agrobacterium-mediated transformation and screening of transformed plant herbicide resistance
[0051] 1) Preparation of Agrobacterium engineering bacteria
[0052] Take the Agrobacterium strains with the expression vector, and add the strains to the culture medium at a ratio of 1:200 to the YEP liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, at 28°C Cultivate to OD at 220rpm 600 0.5-0.6, 5000rpm centrifugation for 5min to collect the bacteria. Resuspend the collected bacteria in the infection solution and adjust to OD 600 1.0-1.2, spare.
[0053] 2) Transformation of Arabidopsis
[0054] A. Soak the whole plant of Arabidopsis thaliana that has bolted and contains flower buds in the Agrobacterium bacterium solution, soak for 5 minutes, take out the Arabidopsis thaliana, and place it in a dark place for 24 hours;
[0055] B. after the plant after infecting waits for 2-3 weeks, gathers the yellow seed pod;
[0056] C. Sow the collected s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More