Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting human DNA TCR beta chain immune repertoire based on high-throughput sequencing and specific primer group thereof

A technology of primer sets and DNA molecules, which is applied in the direction of DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc. It can solve the problems of impact, easy degradation of samples, and inability to provide target gene expression information, etc.

Inactive Publication Date: 2019-03-19
北京迈基诺基因科技股份有限公司
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the genomic DNA template cannot provide the expression information of the target gene, and may be affected by introns
When using RNA as the starting template, monoclonal TCR quantification will introduce a lot of bias due to multiple TCR transcripts, and have to face the problem of easy sample degradation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting human DNA TCR beta chain immune repertoire based on high-throughput sequencing and specific primer group thereof
  • Method for detecting human DNA TCR beta chain immune repertoire based on high-throughput sequencing and specific primer group thereof
  • Method for detecting human DNA TCR beta chain immune repertoire based on high-throughput sequencing and specific primer group thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1, the design of primer set

[0052] Based on a large number of sequence analysis, primer design, primer combination and effect verification, a set of good primers suitable for detecting human DNA β chain immune repertoire by high-throughput sequencing was screened out.

[0053] The target sequence of the primer set covers the portion of human DNA encoding a specific segment in the TCRβ chain. Specific segments are: the downstream part of the V region, the entire D region and the entire J region.

[0054] The primer set consisted of 32 upstream primers and 13 downstream primers.

[0055] Upstream primer -1:5'- TACACGACGCTCTTCCGATCT NNNNNNNNATTTCACTCTGAAGATCCGGTCCAC-3';

[0056] Upstream primer -2:5'- TACACGACGCTCTTCCGATCT NNNNNNNNAAACAGTTCCAAATCGMTTCTCAC-3';

[0057] Upstream primer -3:5'- TACACGACGCTCTTCCGATCT NNNNNNNNCAAGTCGCTTCTCACCTGAATG-3';

[0058] Upstream primer -4:5'- TACACGACGCTCTTCCGATCT NNNNNNNNNGCCAGTTCTCTAACTCTCGCTCT-3';

[0059] Up...

Embodiment 2

[0103] Example 2, Application of Primer Set to Construct Human DNA TCR beta Chain Immune Repertoire DNA Library

[0104] 1. Take human whole blood, use Kangwei Century Universal Genomic DNA Kit and operate according to the instructions, extract genomic DNA, and obtain DNA solution. For the DNA content detection of the DNA solution, the DNA concentration should not be lower than 50ng / μl.

[0105] 2. Take the centrifuge tube, prepare the reaction system according to Table 1, mix well, centrifuge briefly, and then place it in a PCR machine for amplification. The reaction procedure is shown in Table 2.

[0106] Table 1

[0107]

[0108] The active ingredients in the upstream primer mixture are the 32 upstream primers designed in Example 1, and the concentrations of the 32 upstream primers in the upstream primer mixture are all 1 μM.

[0109] The active ingredients in the downstream primer mixture are the 13 downstream primers designed in Example 1, and the concentrations of t...

Embodiment 3

[0133] Embodiment 3, effect verification

[0134] The whole blood of 5 volunteers was taken, and the library was constructed according to the method in Example 2 to obtain a DNA library.

[0135]The 5 DNA libraries were pooled and then subjected to high-throughput sequencing using the Illumina platform.

[0136] The statistics of the data results are shown in Table 5. The sequencing results were compared with the IMGT database data by bioinformatics methods. The obtained data accounted for more than 80% clean data, and the mapped rate with the target region in the database was more than 80%, which met the basic requirements of current project analysis. Shannon entropy and Inverse Simpson's is the result of the diversity index. rawdata base, that is, the amount of original data. cleandata base, that is, the amount of filtered data. Successfully.aligned.reads, that is, the number of reads successfully aligned. Successfully.aliqned.percent, that is, the successful alignment ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting a human DNA TCR beta chain immune repertoire based on high-throughput sequencing and a specific primer group thereof. The invention protects a primer group, which comprises 45 primers as shown from sequence 1 to sequence 45 in a sequence table. The invention further protects a method for establishing a DNA library, which sequentially comprises the following steps: (1) performing PCR amplification by adopting a primer group and using the genome DNA of a to-be-detected sample as a template, and reclaiming an amplified product; and (2) performing PCRamplification by adopting a universal upstream primer and a universal downstream primer of a sequencing platform and taking the amplified product as a template, and reclaiming the amplified product,which is the DNA library encoding TCR beta chain immune repertoire in a human DNA. The primer group can realize multiple PCR amplification in a tube. The TCR beta chain immune repertoire acquired by adopting the primer group or method has the advantages of high sensitivity, high specificity, high repeatability and low experiment cost.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for detecting human DNA TCR beta chain immune repertoire based on high-throughput sequencing and a special primer set thereof. Background technique [0002] T cells rely on the interaction of antigen major histocompatibility complex molecules (MHC) and T cell receptors (TCR) to mediate antigen recognition. TCRs are highly diverse heterodimers composed of two peptide chains (α and β, and occasionally γ and δ). Each peptide chain consists of a variable region and a constant region, and the variable region plays an important role in the process of antigen recognition. The variable region of α chain (or δ chain) consists of V region and J region, and the variable region of β chain (or γ chain) consists of V region, D region and J region. Because different VDJ subtypes are rearranged together, and the process of rearrangement will be accompanied by mutations such as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6869C12Q1/6883C12Q1/6886C12N15/11
CPCC12Q1/6869C12Q1/6883C12Q1/6886C12Q2535/122
Inventor 伍建姬晓雯冯越
Owner 北京迈基诺基因科技股份有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More