Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Efficient recombinant vaccinia virus vector and establishing method thereof

A vaccinia virus vector and recombinant virus technology are applied in the field of high-efficiency recombinant vaccinia virus vector and its establishment to achieve the effects of saving time and cost and improving recombination efficiency

Pending Publication Date: 2019-03-29
INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, CRISPR-Cas9 has been used to knock out N1L, A46R and other genes in the genomes of adenovirus, type Iherpes simple virus, and poxvirus Western Reserve strains and Lister strains, but has not yet Applied to the Tiantan strain of vaccinia virus independently developed by my country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Efficient recombinant vaccinia virus vector and establishing method thereof
  • Efficient recombinant vaccinia virus vector and establishing method thereof
  • Efficient recombinant vaccinia virus vector and establishing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Obtaining recombinant virus by transfecting gRNA-Cas9 plasmid

[0056] 1. Method

[0057] 1.1. Design of gRNA

[0058] For the Tiantan strain vaccinia virus TK region, design gRNA sequences through the website (http: / / crispr.mit.edu / , http: / / www.e-crisp.org / E-CRISP / ), including gRNA1, gRNA2 and gRNA3 ( Such as figure 1 shown).

[0059] The sequence of gRNA1 is: GAAACCGAGATAGAAATAAT;

[0060] The sequence of gRNA2 is: GTTATAGTAGCCGCACTCGA;

[0061] The sequence of gRNA3 is: GTGAGCGTATGGCAAACGA.

[0062] 1.2. Detection of expression and localization of Cas9 protein in gRNA-Cas9 plasmid

[0063] 1.2.1, protein extraction

[0064] At 293T (5×10 5 ) cells were transfected with px330-delNLS, px330-delNLS-gRNA1, px330-delNLS-gRNA2, px330-delNLS-gRNA3, and the cells were harvested after 48 hours. Centrifuge at 3000rpm for 3min, wash once with PBS, add 100μL of cell lysate RIPA, and store at -20°C for later use.

[0065] 1.2.2, Western Blot detection of Cas9 ...

Embodiment 2

[0119] Embodiment 2 obtains recombinant virus by gRNA-Cas9 cell line

[0120] 1. Method

[0121] 1.1. Establishment of cell lines stably expressing gRNA targeting the TK region

[0122] 1.1.1. Construction of Lenti-delNLS-gRNA-Cas9 plasmid

[0123] The gRNA plasmid used above does not contain the resistance gene required for cell selection and cannot be used to construct cell lines, while the Lenti-V2 plasmid contains the puromycin resistance gene and Cas9 gene, so our laboratory will use molecular cloning methods to The NLS of Cas9 in Lenti-V2 was deleted, and then three gRNA sequences targeting the TK region were introduced into Lenti-delNLS to obtain a gRNA plasmid with cytoplasmic localization of Cas9.

[0124] 1.1.2. Establishment of cell lines stably expressing gRNA-Cas9

[0125] 293T cells (5×10 5 ) were inoculated in a six-well plate without antibiotics in complete DMEM medium, cultivated overnight, and when the cell growth was 60% to 70%, the gRNA-Cas9 plasmid was...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The present invention establishes a system for an efficient recombinant vaccinia virus vector and comprises an efficient recombinant vaccinia virus vector and an establishing method thereof. A CRISPR-Cas9 technology is used to knock out a TK region of a vaccinia virus Tiantan strain and then the vaccinia virus Tiantan strain is transfected with a recombinant plasmid pJ2R-EGFP carrying EGFP. A recombinant virus with deletion of TK and insertion of EGFP is obtained by fluorescence screening to establish the system for the efficient recombinant vaccinia virus vector. A molecular cloning technology, a Western Blot experiment, an immunofluorescence and a viral plaque formation test find that a recombination rate in a first round of a recombinant virus screening process is improved compared witha traditional homologous recombination method. Further, the recombinant virus obtained by a PCR technology, an agarose gel electrophoresis and a sequencing verification is accurately modified at specific sites. The vaccinia virus vector is improved in the recombination rate and provides application value in vaccine vector construction, tumor immunotherapy, etc.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a high-efficiency recombinant vaccinia virus vector and its establishment method. Background technique [0002] Poxvirus is a DNA virus with the largest virions, including various types: Vaccinia virus, Variola virus, Cowpox virus and Monkey poxvirus. Among them, Vaccinia virus Tiantan strain (VTT) played an important role in the process of eradicating smallpox. Vaccinia virus has the characteristics of wide host range, many non-essential genes, high conservation, large capacity of exogenous genes, and cytoplasmic replication. [0003] At present, the treatment of tumors is still a worldwide problem. The main methods include radiotherapy and chemotherapy, chimeric antigen receptor T-cell immunotherapy (Chimeric Antigen Receptor T-Cell Immunotherapy, CAR-T) and monoclonal antibody therapy. As a new research direction for tumor therapy, oncolytic virus has achieved som...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/863C12N15/65C12N7/01C12N15/90
CPCC12N7/00C12N9/1211C12N15/65C12N15/86C12N15/902C12Y207/01021C07K14/43595C12N2310/20C12N2710/24021C12N2710/24043
Inventor 郭斐许丰雯张迪
Owner INST OF PATHOGEN BIOLOGY CHINESE ACADEMY OF MEDICAL SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More