Application of gene editing method in Amycolatopsis orientalis

A kind of Amycolatopsis and gene technology, applied in the field of genetic engineering, can solve the problems of low efficiency and achieve the effect of simplifying genetic operation and improving integration efficiency

Inactive Publication Date: 2019-04-12
SHANGHAI JIAO TONG UNIV +1
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current traditional homologous recombination method for genetic manipulation is relatively inefficient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene editing method in Amycolatopsis orientalis
  • Application of gene editing method in Amycolatopsis orientalis
  • Application of gene editing method in Amycolatopsis orientalis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Construction and verification of embodiment 1 plasmid pKCpGcas9EgdgtfD-NA

[0034] Step 1. pKCcas9dO was digested with NdeI / HindIII to obtain the cas9sco vector. The enzyme digestion system was: 2 μL of plasmid, 0.5 μL of NdeI and HindIII endonucleases, 1 μL of Buffer, and water to 10 μL. React in a water bath at 37°C for 2 hours.

[0035] Step 2. Obtaining sgRNA recombinant fragments

[0036] The sgRNA was designed using the vancomycin-synthetic cluster glycosyltransferase gtfD gene of Amycolatopsis orientalis HCCB10007 as the editing object, and pKCcas9dO was used as the template, and the sgRNA recombination fragment was obtained by PCR amplification with primers gRNADNrecom and gtfDgRNArecom, and the fragment size was 103 bp.

[0037] gRNADN recom: ACGTTGTAAAACGACGGCCAGTGCCAAGCTTCTCAAAAAAAGCACCGAC(HindIII)

[0038] (SEQ ID NO: 1)

[0039] gtfDgRNArecom:

[0040] GGCACAATCGTGCCGGTTGGTAGGAACTAGTCGTCGAGATCGCGGTGTCGCGTTTTAGAGCTAGAAA (Spe I) (SEQ ID NO: 2)

[0041] T...

Embodiment 2

[0054] Example 2 Construction of homology arms of CRISPR / Cas9 gene editing system

[0055] Step 1, using the A.orientalis HCCB10007 genome as a template to amplify the upstream and downstream homology arm fragments with Vcm-8F / Vcm-8R and Vcm-10F / Vcm-10R respectively;

[0056] Vcm-8F: AAGCTTAGATCGGTGAGTCGCTGCTG (HindIII) (SEQ ID NO: 7)

[0057] Vcm8R: TCACGTATTTTCCCCGCTGCAGGGTACCTTCGCTACCCCTGTTTCGTG(PstI)(KpnI)

[0058] (SEQ ID NO: 8)

[0059] Vcm10F:AACAGGGGTAGCGAAGGTACCCTGCAGCGGGGAAATACGTGATGCGT(KpnI)(PstI)

[0060] (SEQ ID NO: 9)

[0061] Vcm-10R: AAGCTTTTGGTGATGATCAGGCGGGA (HindIII) (SEQ ID NO: 10)

[0062] Step 2. After the amplified upstream and downstream products are recovered by the DNA recovery kit, Overlap (overlap extension PCR method) recombination is carried out, and the obtained gtfD homology arm fragments are recovered by the DNA recovery kit, followed by T / A cloning and sequencing. The correct plasmid was recovered after digestion with KpnI / PstI;

[0063]...

Embodiment 3

[0070] Example 3 Construction of CRISPR / Cas9 editing plasmids containing gtfD gene homology arms

[0071] According to the instructions of the homologous recombination kit, the gtfD homology arm with green fluorescent protein obtained in Example 2 was integrated into pKCpGcas9EgdgtfD-NA to obtain an editing plasmid containing the homology arm of the gtfD gene. The specific operation is as follows:

[0072] Step 1. The pKCpGcas9EgdgtfD-NA backbone plasmid is linearized by HindIII digestion;

[0073] Step 2, calculating the amount of DNA required for the recombination reaction according to the formula. (To ensure the accuracy of sample addition, the sample volume of each component should not be less than 1 μl).

[0074] Linearized vector: X=[0.02*base pair number of cloning vector]ng, insert fragment: Y=Y 1 +Y 2 …+Y n =[0.04*number of base pairs per insert]ng, 2*ClonExpress Mix 5μl, add water to 10μl;

[0075] Step 3, configure the reaction system;

[0076] Step 4. Use a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 editing system based method for gene knockout and gene knock-in in Amycolatopsis orientalis. The method introduces a CRISPR / Cas9 edited plasmid pLYNY04 into Amycolatopsis orientalis HCCB10007, realizes gene knockout and gene knock-in, simplifies genetic operation and improves the integration efficiency of the Amycolatopsis orientalis. The invention also discloses a CRISPR / Cas9 edited plasmid pLYNY04 containing a gtfD gene homologous arm; and eGFP is inserted into a target sequence of the Amycolatopsis orientalis to facilitate detection of gene editing results. The invention also discloses application of the CRISPR / Cas9 edited plasmid pLYNY04 containing the gtfD gene homologous arm.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to the application of a gene editing method in Amycolatopsis orientalis. Background technique [0002] CRISPR / Cas9 system, which is a fast and simple new technology for genome editing currently developed, only needs to combine a single Cas9 protein with sgRNA to recognize and cut specific DNA sequences to complete highly efficient genes edit. Taking advantage of this feature, the Cas9 system can be successfully combined with the in vitro recombination system to accurately clone fragmented DNA directly from the chromosome. Since CRISPR / Cas technology was applied to gene knockout in 2013, this molecular tool with fast construction, simple structure and high efficiency has been quickly accepted by everyone, and has been successfully applied to rice, wheat, malaria parasite, fruit fly, In eukaryotic organisms such as zebrafish and mammals. Not only in eukaryot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/74C12N15/90C12N15/65C12N15/54C12N1/21C12N15/11C12R1/01
CPCC12N15/74C12N9/1048C12N15/65C12N15/902C12N2810/10
Inventor倪瑶魏维钱秀萍夏兴戈梅
OwnerSHANGHAI JIAO TONG UNIV