Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation and application of XIST-modified adipose-derived mesenchymal stem cell exosomes

An adipose-derived, quality stem cell technology, applied in the direction of cells modified by introducing foreign genetic material, applications, medical preparations containing active ingredients, etc., can solve the problems of limited preparation technology, difficult to prepare in large quantities, and reduce the effective dose , good effect of macrophage function phenotype regulation, good effect of liver disease treatment

Active Publication Date: 2019-05-10
ZHEJIANG UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although AMSC-Exo has more advantages in terms of safety and stability, and has shown encouraging curative effects in animal models of liver diseases, the amount required for the same curative effect far exceeds the amount of AMSCs transplanted to achieve a better curative effect. The amount of AMSC-Exo infused in a mouse requires nearly 1 / 3 of the mouse's adipose tissue
However, due to the limitations of the current MSC-Exo preparation technology, it is still difficult to prepare a large amount of MSC-Exo that meets the clinical therapeutic dose.
Therefore, the promotion of its clinical application still depends on improving its efficacy through modification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation and application of XIST-modified adipose-derived mesenchymal stem cell exosomes
  • Preparation and application of XIST-modified adipose-derived mesenchymal stem cell exosomes
  • Preparation and application of XIST-modified adipose-derived mesenchymal stem cell exosomes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 AMSC-XIST-Exo can mediate the delivery of XIST to macrophages

[0037] The RNAs of AMSC-XIST-Exo, AMSC-Ctrl-Exo and native AMSC-Exo were extracted by ncRNA kit, and then reverse transcribed. Reverse transcription system: RNA template - 1 μg; 200 μM random primer - 1 μl; 25 μM Oligo(dT) - 1 μl; 5× reverse transcription buffer - 2 μl; reverse transcriptase mixture - 2 μl; RNase-free water - make up to 10 μl. The reverse transcription reaction program was: 60 min at 42°C, 10 min at 70°C. Then perform fluorescent quantitative PCR detection, the PCR system is: 2×SYBR Green Mix-10 μl; the sequence of the upstream primer of XIST is shown in SEQ:NO. Shown: ggaaagaagaatgcagagccctgtacaaccttccttcctg, 5 μM - 0.8 μl; template - 2ul; dd water - make up to 20 μl. The PCR conditions were: 95°C pre-denaturation for 10 minutes, followed by 40 cycles of 95°C for 5s, 60°C for 30s, and 72°C for 30s. Such as figure 1 As shown, AMSC-XIST-Exo contains a high level of XIST.

[00...

Embodiment 2

[0040] Example 2 AMSC-XIST-Exo regulates macrophage phenotype

[0041] Add gradient concentrations of AMSC-XIST-Exo, AMSC-Ctrl-Exo and native AMSC-Exo (0.2 μg / mL, 4 μg / mL, 80 μg / mL) to macrophage RAW264.7, and add corresponding volume of PBS as In the control group (Vehicle), the cells were collected after 24 hours for qPCR analysis of macrophage phenotype-related molecules.

[0042] Compared with AMSC-Ctrl-Exo and natural AMSC-Exo, AMSC-XIST-Exo can more significantly up-regulate the expression of molecules related to M2 phenotype of macrophages Arg1 and Fizz-1, while down-regulate the expression of M1 phenotype under the same concentration conditions Expression of related molecules CD86 and iNOS. AMSC-XIST-Exo can significantly affect the expression of M1 / 2 phenotype-related molecules at a concentration of 0.2 μg / mL, while AMSC-Ctrl-Exo and native AMSC-Exo can significantly regulate the M1 / 2 phenotype at a concentration of 80 μg / mL Expression of related molecules ( figur...

Embodiment 3

[0043] Example 3 AMSC-XIST-Exo regulates the secretion of macrophage inflammatory factors

[0044] Macrophages RAW264.7 were treated with gradient concentrations of AMSC-XIST-Exo, AMSC-Ctrl-Exo and natural AMSC-Exo (0.2 μg / mL, 4 μg / mL, 80 μg / mL) for 24 hours, and corresponding volumes of PBS was used as the control group (Vehicle); then stimulated with LPS (100ng / mL) for 12h, and then ELISA was used to detect the levels of IL-1β, IL-6 and TNF-α in the cell supernatant.

[0045] Compared with AMSC-Ctrl-Exo and natural AMSC-Exo, AMSC-XIST-Exo can significantly reduce the levels of LPS-induced macrophage inflammatory factors IL-1β, IL-6 and TNF-α under the same concentration conditions. secretion. AMSC-XIST-Exo can significantly inhibit the secretion of macrophage inflammatory factors at a concentration of 0.2 μg / mL, and its inhibitory effect is comparable to that of AMSC-Ctrl-Exo and natural AMSC-Exo at a concentration of 80 μg / mL ( image 3 ).

[0046] Moreover, the AMSC-Exo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides preparation and application of XIST-modified adipose-derived mesenchymal stem cell exosomes. By constructing an XIST-modified AMSC, preparing the exudates thereof, and determining the regulation advantage of the AMSC-XIST-Exo on the functional phenotype of the macrophage at a cell level through experiments such as ELISA, WB, streaming and the like, through in vivo experiments, the curative effect of the XIST-modified AMSC-derived exosomes on liver diseases and the effect advantage of the XIST-modified AMSC-derived exosomes on regulating the functional phenotype of livermacrophages are determined. The effective dosage of AMSC-XIST-Exo can be as low as 1 mg / kg. The XIST-modified adipose-derived mesenchymal stem cell exosomes greatly reduces the dose (reduced by tensof times) required by exosol treatment, and improves the application potential of AMSC-Exo and even MSC-Exo in the clinical treatment of liver diseases.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to the preparation and application of mesenchymal stem cell-derived exosomes, in particular to XIST (X inactive specific transcript)-modified adipose-derived mesenchymal stem cell exosomes (AMSC-XIST-Exo ) preparation and its application. Background technique [0002] The mechanism of liver inflammation is very complex, involving many factors such as etiology, host genetics, body immunity, and clinical intervention, among which the body's immune response plays a decisive role in the occurrence and development of liver inflammation. Various innate immune cells, such as monocytes / macrophages, natural killer cells, and dendritic cells, are recruited, activated, and proliferated in the inflamed liver, suggesting that the innate immune system plays a very important role in the immune inflammatory response of the liver. Hepatic macrophages account for more than 80% of the total macrophages in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N5/10A61K35/28A61P1/16
Inventor 刘艳宁楼国华
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More