Breast cancer autoimmune antibody detection kit and preparation method and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology for autoimmune antibodies and detection kits, which is applied in the field of kits, can solve the problems of low specificity and sensitivity, inaccurate results, and fewer detection kits, and achieve broad market prospects, fast and convenient detection, and high sensitivity Effects with specificity
Inactive Publication Date: 2019-05-14
杭州京北生物科技有限公司
View PDF5 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0008] The purpose of the present invention is to provide a breast cancer-related detection kits in order to solve the defects of less time-consuming detection, inaccurate results, low specificity and sensitivity, and many interference factors affectin
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Examples
Experimental program
Comparison scheme
Effect test
Embodiment
[0056] Embodiment A breast cancer autoimmune antibody detection kit, said kit contains fusion protein, buffer solution 1 (phosphate Tween buffer), enzyme substrate (renilla luciferase substrate), buffer solution 2 ( luciferase substrate assay buffer), negative control, positive control and 96-well plate.
[0057] The preparation method of breast cancer autoimmune antibody detection kit, described preparation method is:
[0058] Construction of the fusion vector of luciferase gene and antigen gene:
[0059] Select the luciferase gene and the target sequence of the multi-antigen gene HER2 antigen gene sequence and MUC1 antigen gene sequence for PCR amplification, introduce restriction endonuclease at the kpnl site ggtacc, obtain the target fragment, and perform gel electrophoresis for identification; Primers were designed according to the HER2 gene sequence Genebank: NC_000017.11,
[0060] Forward primer 5'cggggtaccccgatgccccgg3',
[0061] Reverse primer 5'tgctctagatcacactgg3...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention relates to a kit. The kit adopts a gene recombinant Renilla and multi-antigen fusion protein to detect an autoimmune antibody in serum, which is related to the breast cancer, has high sensitivity and specificity, provides basis for diagnosis of the breast cancer, and provides scanning conditions for further pathological diagnosis. The kit is rapid and convenient to detect, accurate in detection result and harmless for a patient, has no radio-immunity pollution, can meet requirements of clinical diagnosis and particularly requirements of primary health care institutions and community general practitioners, and has wide market prospect.
Description
technical field [0001] The invention relates to a kit, in particular to a breast cancer autoimmune antibody detection kit that is fast and convenient to detect, has accurate detection results, does no harm to patients and has no radioimmune pollution, and can meet the needs of clinical diagnosis, as well as its preparation method and application . Background technique [0002] At present, the detection kits related to detection of breast cancer on the market generally detect tumor markers such as antigens, susceptibility genes, tumor suppressor genes, and epidermal growth factor receptor-2 (Her-2), etc., as follows: [0003] Carcinoembryonic antigen (CEA), ferritin, monoclonal antibody CA (CA153, CA549), epidermal growth factor receptor-2 (Her-2), estrogen, progesterone, estrogen receptor and progesterone receptor (ER , PR), epithelial growth factor receptor (EGFR), tumor suppressor gene P53, susceptibility genes BRCA1, BRCA2, autoantibody MMP-7, IGBR, CD117, BCL-2, PCNA, e...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more