Breast cancer autoimmune antibody detection kit and preparation method and application thereof
A technology for autoimmune antibodies and detection kits, which is applied in the field of kits, can solve the problems of low specificity and sensitivity, inaccurate results, and fewer detection kits, and achieve broad market prospects, fast and convenient detection, and high sensitivity Effects with specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment
[0056] Embodiment A breast cancer autoimmune antibody detection kit, said kit contains fusion protein, buffer solution 1 (phosphate Tween buffer), enzyme substrate (renilla luciferase substrate), buffer solution 2 ( luciferase substrate assay buffer), negative control, positive control and 96-well plate.
[0057] The preparation method of breast cancer autoimmune antibody detection kit, described preparation method is:
[0058] Construction of the fusion vector of luciferase gene and antigen gene:
[0059] Select the luciferase gene and the target sequence of the multi-antigen gene HER2 antigen gene sequence and MUC1 antigen gene sequence for PCR amplification, introduce restriction endonuclease at the kpnl site ggtacc, obtain the target fragment, and perform gel electrophoresis for identification; Primers were designed according to the HER2 gene sequence Genebank: NC_000017.11,
[0060] Forward primer 5'cggggtaccccgatgccccgg3',
[0061] Reverse primer 5'tgctctagatcacactgg3...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com