Method for constructing lethal gene systemic knockout mouse model with CRISPR/Cas9 system

A mouse model and systemic technology, applied in the biological field, can solve the problem of inability to achieve a systemic knockout mouse model of lethal genes, and achieve the effects of short production cycle, reduced production cost, and cumbersome production steps.

Inactive Publication Date: 2019-05-21
CAPITAL UNIVERSITY OF MEDICAL SCIENCES
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the establishment of a systemic knockout mouse model of the lethal gene that can be subcultured cannot be achieved by microinjection of fertilized eggs using the CRISPR / Cas9 system

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing lethal gene systemic knockout mouse model with CRISPR/Cas9 system
  • Method for constructing lethal gene systemic knockout mouse model with CRISPR/Cas9 system
  • Method for constructing lethal gene systemic knockout mouse model with CRISPR/Cas9 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] A method of using the CRISPR / Cas9 system to construct a systemic knockout mouse model of the postnatal lethal gene Slc17a5 that can be subcultured by microinjection of two-cell embryos. The present invention will be further described below in conjunction with specific examples.

[0056] 1.1 Construction of CRISPR-Cas9 system components

[0057] 1.1.1 Design of sgRNA sequence for gene knockout

[0058] (1) Enter the NCBI website and query the Gene ID of mouse Slc17a5: 235504.

[0059] (2) Enter https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design website, enter Gene ID to find available sgRNA.

[0060] (3) Select the sgRNA according to the score given by the website. The higher the score, the lower the off-target effect and the better the specificity of the sgRNA. At the same time, the position of the sgRNA on the CDS must also be considered comprehensively, and the domain architecture retrieval tool of NCBI is used to predict which important domai...

Embodiment 2

[0183] A method of using the CRISPR / Cas9 system to construct a subcultured embryonic lethal gene Virma systemic knockout mouse model through two-cell embryo microinjection. The present invention will be further described below in conjunction with specific examples.

[0184] 2.1 Construction of CRISPR-Cas9 system components

[0185] For detailed steps, refer to the method in 1.1, Gene ID of Virma: 66185. sgRNA sequence, sgRNA1 sequence is 5'-CUAUGGGCUCGUACUCCCGG-3' (SEQ ID NO.2).

[0186] Oligodeoxynucleotide (DNA oligo, 5'→3') synthesized by Sangon Biotech

[0187] sgRNA1F: taatacgactcactatagCTATGGGCTCGTACTCCCGGgtttaagagctatgctggaaa (SEQ ID NO. 7);

[0188] sgRNAR:aaaagcaccgactcggtgcc (SEQ ID NO.4)

[0189] Finally, the in vitro transcription and purification of Virma sgRNA1 and Cas9 mRNA were completed.

[0190] 2.2 Two-cell embryo microinjection and embryo transfer in mice

[0191] Detailed steps are with reference to the method of step 1.2 in embodiment 1

[0192] Vir...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to a method for constructing a lethal gene systemic knockout mouse model with a CRISPR / Cas9 system. The method includes the followingsteps that 1, an sgRNA sequence for efficiently identifying a lethal gene PAM region after knockout is designed; 2, mRNA or protein of Cas9 is mixed with the sgRNA designed in step 1, microinjectionis performed on any blastomere cell in a mouse two-cell embryo with the mixture, embryo transplantation is performed after injection, and strain gene identification is performed to obtain a chimeric positive founder with the lethal gene knocked out; 3, the positive founder and a wild-type mouse are mated to generate an F1 generation, a heterozygous F1-generation mouse with the lethal gene systemically knocked out is finally obtained after gene identification, and construction of the mouse model capable of realizing passage propagation is completed. Compared with the prior art in which a lethalgene systemic knockout mouse model is constructed by ES cell gene targeting, the method in the technical scheme has the advantages that the operation steps are simple, the operation difficulty is low, the production cycle is short, and the cycle is only about 4 months.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for constructing a lethal gene systemic knockout mouse model using the CRISPR / Cas9 system. Background technique [0002] Systemic gene knockout mouse model is a relatively common method in the study of gene function, and is widely used in the study of the function of target genes on systemic physiology or pathology. Among them, lethal genes have received special attention because they play important roles in the body. Lethal genes refer to a class of genes whose loss of gene function leads to the death of individuals during the embryonic period and after birth, including embryonic lethal genes and postnatal lethal genes. The mouse model with systemic knockout of the lethal gene must be subcultured in the form of heterozygotes. Studies predict that lethal genes account for about 23% of mouse genes (Cell, 2013, 154:452; Nature 2016, 537:508). [0003] The method of gene tar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12N9/22A01K67/027
Inventor卢静仵毅陈柏安鲁飞翔
OwnerCAPITAL UNIVERSITY OF MEDICAL SCIENCES