Kit for detecting cancer radiotherapy sensitivity and application thereof

A technology for detecting reagents and sensitivity, which is applied in the field of compositions for predicting radiotherapy sensitivity before treatment, can solve problems such as no kit detection, and achieve the effect of predicting radiotherapy tolerance/sensitivity

Active Publication Date: 2021-10-29
SUN YAT SEN UNIV CANCER CENT
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is a lack of key tumor molecular markers clinically used to detect the radiotherapy sensitivity of locally advanced rectal cancer, and there is no corresponding kit for detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting cancer radiotherapy sensitivity and application thereof
  • Kit for detecting cancer radiotherapy sensitivity and application thereof
  • Kit for detecting cancer radiotherapy sensitivity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Example 1 Screening process of genome-wide shRNA library in colorectal cancer cells and construction of radiotherapy-resistant cells

[0094] The screening process is as figure 1 As shown, specifically, the entire genome shRNA library (including 75,000 shRNAs, covering about 15,000 genes) was transfected into the colorectal cancer cell line HCT116 / HT29 in the form of lentiviral vector (transfection efficiency, MOI: 0.4), After stable selection by puromycin, the cells were divided into irradiation treatment group and control group, cultured for 7 days after treatment, DNA was extracted and amplified, and the shRNA copy number change was analyzed by next-generation sequencing. Significantly down-regulated genes were selected as candidate genes.

[0095] Next, if figure 2 As shown, the colorectal cancer cell line HCT116 was induced by long-term stepwise radiation to construct a stable cell line with a radiation dose of 6Gy for further screening.

Embodiment 2

[0096]Example 2 Quantitative PCR detection of mRNA levels of candidate genes in radiation-resistant and sensitive cells

[0097] The total RNA in the cells was extracted by the Trizol method, and 2 μg of the total RNA was reverse-transcribed into cDNA. Then perform reverse transcription reaction according to the requirements of the reverse transcription system to obtain cDNA. By querying the gene database of NCBI, the cDNA sequences of RFC4 and GAPDH (internal reference) were obtained, and PCR primers were designed according to the sequences as follows:

[0098] RFC4:

[0099] The upstream primer sequence is shown in SEQ ID NO: 1,

[0100] The downstream primer sequence is shown in SEQ ID NO:2.

[0101] GAPDH (internal reference):

[0102] Upstream primer sequence: AGAAGGCTGGGGCTCATTTG,

[0103] Downstream primer sequence: AGGGGCCATCCACAGTCTTC.

[0104] Real Time PCR: According to Instructions for Premix Ex TaqTM II (TaKaRa), the formula for preparing the PCR reaction ...

Embodiment 3

[0109] Example 3 Changes in protein expression level of RFC4 before and after radiotherapy

[0110] Protein immunoassays were used to detect changes in RFC4 protein content at the cellular level. The main steps included: extraction of total protein in cells, preparation of protein loading buffer, SDS-PAGE electrophoresis, electrotransfer to PVDF membrane, and western blotting (anti-RFC4( PA5-21538) antibody (1:1000) was incubated with anti-β-actin (8H10D10, American Saixintong Company) antibody (1:1000)) and so on.

[0111] The result is as Figure 4 As shown, with the gradual increase of radiation dose, the protein level of RFC4 is also up-regulated. Combined with the results in Example 2, it shows that RFC4 is the most credible radiotherapy tolerance factor among the candidate genes.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a kit for detecting cancer radiotherapy sensitivity and its application in curative effect prediction. The screening of molecular markers in the present invention is entirely based on a more practical and effective screening method at the international research level—the whole genome RNAi library filter. The identification was carried out step by step based on the induction process of radiotherapy tolerance in vivo and in vitro, and finally RFC4 was found to be a gene very related to radiotherapy tolerance of colorectal cancer. Moreover, clinical retrospective analysis and in vitro and in vivo functional analysis of the RFC4 genes identified by screening have found that higher expression levels can be positively correlated with poor tumor regression, and can be used to predict radiotherapy tolerance / sensitivity. Based on the above findings, it is very important to obtain a kit for predicting the efficacy of neoadjuvant radiotherapy in locally advanced stages, which is very important for solving the problems of inter-individual differences in clinical efficacy and the blank prediction of shrinkage effect / prognosis effect, and better realizing precise treatment Practical significance.

Description

technical field [0001] The invention belongs to the field of molecular diagnosis and relates to a method capable of predicting the curative effect of radiotherapy for locally advanced rectal cancer, in particular to a composition developed based on the radiotherapy resistance gene RFC4 of colorectal cancer and applied to predict radiotherapy sensitivity before treatment . Background technique [0002] In recent years, the incidence of rectal cancer in my country has been increasing year by year, seriously threatening people's health. Especially for middle and low locally advanced rectal cancer, surgical resection is more difficult, the risk of local recurrence is high, and the prognosis is poor. At present, domestic and foreign guidelines recommend neoadjuvant chemoradiotherapy combined with surgical resection as the standard treatment mode for locally advanced rectal cancer. [0003] Neoadjuvant chemotherapy and radiotherapy can improve the local control rate, surgical re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): G01N33/574G01N33/533G01N33/535
Inventor刘然义岳欣王雪涔黄文林
OwnerSUN YAT SEN UNIV CANCER CENT