Primer pair for detecting rice brown planthopper resistance gene Bph14 and application thereof

Abstract

The invention discloses a primer pair for detecting a rice brown planthopper resistance gene Bph14 and an application thereof. The primer pair for detecting the rice brown planthopper resistance geneBph14 is a co-dominance marker primer B14InD. The co-dominance marker primer B14InD is as follows: a forward primer sequence: CTACTGATTGCAGATTGACG; and a reverse primer sequence: CACTTGGTGAACTTATTCCCTT. The primer pair for detecting the rice brown planthopper resistance gene Bph14 is used for performing PCR amplification to obtain a Bph14 specificity co-dominance molecular marker, and the brown planthopper resistance gene positioned by the Bph14 specificity co-dominance molecular marker is clear in position. Through detecting the specificity co-dominance molecular marker of the Bph14 gene, namely genetype detection applied to rice varieties or strains, brown planthopper resistance of a rice plant can be forecasted, and it is beneficial to improve seed breeding efficiency of brown planthopper resistance rice.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of molecular markers, in particular to a pair of primers for detecting the brown planthopper resistance gene Bph14 in rice and its application. Background technique [0002] Rice is one of the main food crops in my country, and the brown planthopper is the most serious pest of rice. Both its adults and nymphs can directly suck the phloem juice of rice, resulting in yellow leaves and even death of plants. The outbreaks of brown planthopper populations mostly occurred in the mature grain-filling stage of rice, and the damage area expanded from south to north, the frequency of occurrence increased, and the degree of damage increased. According to the China Agricultural Yearbook, at present, rice planthoppers (mainly brown planthoppers) occur in an area of ​​more than 20 million hectares every year in China, and the annual direct yield loss caused by ...

AI Technical Summary

Problems solved by technology

[0006] Due to the complexity of the identification of insect resistance of rice materials, in the backcross breeding of conventional insect-resistant genes, the group identification method at the seedling stage is generally used. Identification to determine contemporary pest resistance

Therefore, the transfer efficiency of insect-resistant genes using conventional breeding methods is low, and it is often difficult to effectively introduce or aggregate different insect-resistant genes, which is not conducive to improving the breeding efficiency of insect-resistant rice.

Images