Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof

A technology of polymyxa-like spores and bacteriostatic peptides, applied to bacteria, methods based on microorganisms, preservation of meat/fish with chemicals, etc., can solve problems such as body toxicity, achieve strong antibacterial properties, good stability, and antibacterial broad spectrum effect

Pending Publication Date: 2019-07-26
NANJING NORMAL UNIVERSITY
View PDF18 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, artificially synthesized chemical preservatives occupy a dominant position in my country's food industry due to their low cost, convenient use, and good antiseptic effect. However, these synthetic preservatives will have a negative impact on the flavor and taste of food during use, and will It is absorbed by the body together with the food, causing certain toxic effects on the body

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof
  • Bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof
  • Bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Isolation and Purification of Paenibacillus polymyxa XW4

[0028] (1) Take out the lake mud collected from Xuanwu Lake in Nanjing, weigh 1g of the lake mud and put it in a test tube with 9ml of sterile saline, mix it with a vortex mixer; Under the condition, carry out serial dilution, respectively from 10 -3 、10 -4 、10 -5 There is no unit for the three dilutions, and 0.1ml of the dilution is drawn from the sample suspension of the dilution, and they are respectively spread on the LB solid plate, cultured at 37°C, and a single colony on the medium plate is selected for four zones Stretch, culture at 37°C for 24-48 hours, repeat the streaking 2-3 times to obtain the purified strain, carry out Gram staining and catalase experiments on the purified strain, and select Gram staining as Positive, catalase-negative strains.

[0029] (2) Inoculate the completely purified bacterial strain in step 1 into liquid LB medium, and culture it statically at 37°C for 24 hours to obtai...

Embodiment 2

[0039] Identification of bacteriostatic-producing strain XW4

[0040] A bacteriostatic-producing strain XW4 screened in Example 1 was cultured to the logarithmic growth phase, and its genomic DNA was extracted. The 16srDNA fragment was amplified by the bacterial universal primers SEQ ID NO.1F27 (AGAGTTTGATCCTGGCTCAG) and SEQ ID NO.2R1492 (TACGGCTACCTTGTTACGACTT), and sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. The full length of the sequence is 1498bp, see Sequence table SEQ ID NO.3; through sequence comparison, using BLAST analysis method, the complete sequence of Paenibacillus polymyxa XW4 of the present invention is compared with the gene sequence of Paenibacillus polymyxa registered in NCBI, and the homology is 99 %, see Table 3, combined with the results of physiological and biochemical experiments of bacterial strain XW4, it was identified as Paenibacillus polymyxa (Paenibacillus polymyxa), named as Paenibacillus polymyxa (Paenibacillus polymyxa) X...

Embodiment 4

[0045] Effects of Paenibacillus polymyxa XW4 bacteriostatic peptide on dominant spoilage bacteria of Procambarus clarkii

[0046] (1) Preparation of crude antimicrobial peptide

[0047] Inoculate Paenibacillus polymyxa XW4 into LB liquid medium, and culture it on a shaker at 220rmp at 37°C for 24 hours to obtain the strain fermentation broth. Centrifuge the fermentation broth at 4°C and 10,000r / min for 10 minutes, and reserve Serum. The fermentation supernatant was frozen into powder to obtain powdered bacteriostatic peptide, which was stored in a refrigerator at 4°C.

[0048] (2) Antibacterial effect of crude antimicrobial peptides on the dominant spoilage bacterium Lysinibacillus in Crayfish

[0049] Use 10mm ddH 2 O redissolve bacteriostatic peptide powder as bacteriostatic agent with 10ml ddH 2 O back dissolves 1g antimicrobial peptide powder, uses lysine bacillus as indicator bacteria indicator bacteria concentration 10 8 cfu / ml, add 100ul for coating, use a hole pun...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pore sizeaaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof. It is authenticated that the paenibacillus polymyxa has been preserved in the General Microbiology Center of China Microbiological Culture Collection and Management Committee, the preservation time is 26 November 2018, and the preservation number is CGMCC NO.16780. The bacteriostatic peptide-producing paenibacillus polymyxa XW4 has good tolerance and stability under a high-temperature condition, and a produced bacteriostatic peptide has a broad-spectrum bacteriostatic effect, has a good bacteriostatic effect on dominant putrefactive bacteria of procambarus clarkii, and has a wide application prospect in food preservation.

Description

technical field [0001] The invention belongs to the technical field of food microorganisms, and relates to a strain of Paenibacillus polymyxa, in particular to a strain of Paenibacillus polymyxa XW4 producing bacteriostatic peptide and its isolation, screening and application Background technique [0002] At present, a large number of food preservatives have been used in various food industries to prevent food from spoiling and prolong the shelf life of food. Among them, artificially synthesized chemical preservatives occupy a dominant position in my country's food industry due to their low cost, convenient use, and good antiseptic effect. However, these synthetic preservatives will have a negative impact on the flavor and taste of food during use, and will It is absorbed by the body together with the food, causing certain toxic effects on the body. In contrast, natural preservatives derived from animals, plants and microorganisms have the characteristics of safety, no toxic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A23B4/22A23B4/20C12R1/01
CPCC12N1/20A23B4/22A23B4/20A23V2002/00C12R2001/01C12N1/205A23V2200/10A23V2250/55
Inventor 周涛满文曾胡容封嗣中罗海波
Owner NANJING NORMAL UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More