Bacteriostatic peptide-producing paenibacillus polymyxa XW4 and separation, screening and application thereof
A technology of polymyxa-like spores and bacteriostatic peptides, applied to bacteria, methods based on microorganisms, preservation of meat/fish with chemicals, etc., can solve problems such as body toxicity, achieve strong antibacterial properties, good stability, and antibacterial broad spectrum effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Isolation and Purification of Paenibacillus polymyxa XW4
[0028] (1) Take out the lake mud collected from Xuanwu Lake in Nanjing, weigh 1g of the lake mud and put it in a test tube with 9ml of sterile saline, mix it with a vortex mixer; Under the condition, carry out serial dilution, respectively from 10 -3 、10 -4 、10 -5 There is no unit for the three dilutions, and 0.1ml of the dilution is drawn from the sample suspension of the dilution, and they are respectively spread on the LB solid plate, cultured at 37°C, and a single colony on the medium plate is selected for four zones Stretch, culture at 37°C for 24-48 hours, repeat the streaking 2-3 times to obtain the purified strain, carry out Gram staining and catalase experiments on the purified strain, and select Gram staining as Positive, catalase-negative strains.
[0029] (2) Inoculate the completely purified bacterial strain in step 1 into liquid LB medium, and culture it statically at 37°C for 24 hours to obtai...
Embodiment 2
[0039] Identification of bacteriostatic-producing strain XW4
[0040] A bacteriostatic-producing strain XW4 screened in Example 1 was cultured to the logarithmic growth phase, and its genomic DNA was extracted. The 16srDNA fragment was amplified by the bacterial universal primers SEQ ID NO.1F27 (AGAGTTTGATCCTGGCTCAG) and SEQ ID NO.2R1492 (TACGGCTACCTTGTTACGACTT), and sent to Sangon Bioengineering (Shanghai) Co., Ltd. for sequencing. The full length of the sequence is 1498bp, see Sequence table SEQ ID NO.3; through sequence comparison, using BLAST analysis method, the complete sequence of Paenibacillus polymyxa XW4 of the present invention is compared with the gene sequence of Paenibacillus polymyxa registered in NCBI, and the homology is 99 %, see Table 3, combined with the results of physiological and biochemical experiments of bacterial strain XW4, it was identified as Paenibacillus polymyxa (Paenibacillus polymyxa), named as Paenibacillus polymyxa (Paenibacillus polymyxa) X...
Embodiment 4
[0045] Effects of Paenibacillus polymyxa XW4 bacteriostatic peptide on dominant spoilage bacteria of Procambarus clarkii
[0046] (1) Preparation of crude antimicrobial peptide
[0047] Inoculate Paenibacillus polymyxa XW4 into LB liquid medium, and culture it on a shaker at 220rmp at 37°C for 24 hours to obtain the strain fermentation broth. Centrifuge the fermentation broth at 4°C and 10,000r / min for 10 minutes, and reserve Serum. The fermentation supernatant was frozen into powder to obtain powdered bacteriostatic peptide, which was stored in a refrigerator at 4°C.
[0048] (2) Antibacterial effect of crude antimicrobial peptides on the dominant spoilage bacterium Lysinibacillus in Crayfish
[0049] Use 10mm ddH 2 O redissolve bacteriostatic peptide powder as bacteriostatic agent with 10ml ddH 2 O back dissolves 1g antimicrobial peptide powder, uses lysine bacillus as indicator bacteria indicator bacteria concentration 10 8 cfu / ml, add 100ul for coating, use a hole pun...
PUM
Property | Measurement | Unit |
---|---|---|
pore size | aaaaa | aaaaa |
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap