Unlock instant, AI-driven research and patent intelligence for your innovation.

High-throughput protein analysis method and applicable library thereof

An analysis method and protein technology, applied in proteomics research and biological fields, can solve problems such as different batches of antibody preparation, protein lack of antibodies, and antibody powerlessness, etc., to achieve the effects of reducing research and development time, improving reliability, and simplifying research

Inactive Publication Date: 2019-08-06
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the study of protein function, the preparation of corresponding antibodies has become an essential work, but the acquisition of antibodies has the following problems: 1) The preparation is cumbersome and costly; 2) Many proteins lack antibodies; 3) The specificity and research of antibodies from different sources Different purposes lead to a wide variety of antibodies for the same protein, and different antibodies must be selected according to different experiments; 4) Many antibodies are powerless when studying proteins in cells and in vivo; 5) Different batches of antibodies prepared by the same antibody company may cause natural differences etc.
However, the current research on biomacromolecules lacks a system suitable for in vivo, real-time and dynamic research.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-throughput protein analysis method and applicable library thereof
  • High-throughput protein analysis method and applicable library thereof
  • High-throughput protein analysis method and applicable library thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Tandem affinity purification (TAP)-tag marking of 40 mouse genes containing bromodomain

[0109] Forty mouse genes containing bromodomain (Table 1) were tagged with Tandem affinitypurification (TAP)-tag, and TAP-tag was used to fish out the protein complex or DNA sequence that binds to the tagged protein, so that subsequent mass spectrometry MS and Chip -seq experiments. Through MS and Chip-seq detection of 40 mouse genes containing similar bromodomains, the binding protein network and the specificity of DNA binding regions were analyzed, and the function and division of labor of bromodomain proteins were further studied in depth.

[0110] Table 1. List of 40 mouse genes containing bromodomain

[0111]

[0112] A. Selection of TAP-tag sequence and marker position

[0113] Taking the Brd4 protein as an example, Brd4 has three isoforms in total, and isoforms 1, 2, and 3 express 1401, 724, and 1402 amino acids respectively ( figure 1 A), select the full-length protei...

Embodiment 2

[0201] Example 2: Construction of tagged mice for the N-terminal KI Flag of Phf7

[0202] Since there is no easy-to-use Phf7 antibody on the market, in order to study the function of the gene, a 3×Flag sequence was inserted into the N-terminal of the Phf7 endogenous genome of the androgenic haploid embryonic stem cells ( Figure 9 A), and obtain Phf7-KI-Flag heterozygous mouse F0 by ICAHCI injection, obtain Phf7-KI-Flag homozygous male mouse by mating between F1 heterozygous mice ( Figure 9 B).

[0203] Phf7-N-Flag sgRNA sequence (SEQ ID NO:54): TTCTAGATAGGAAGGACAGA

[0204] Phf7-N-Flag left and right homology arm amplification primer sequences:

[0205] Phf7-gN-F (SEQ ID NO:55): aaagtagatccccgtggggacac

[0206] Phf7-gN-R (SEQ ID NO:56): gtttgtacggctgacaaggagc

[0207] Phf7-Flag expression was detected in different germ cells isolated from Phf7-KI-Flag homozygous male mice ( Figure 9 C). And Co-IP was used to detect the expression of Phf7-Flag in the germ cells of Phf7...

Embodiment 3

[0208] Embodiment 3: Construction of the mouse of the C-terminal KI Flag of Hspg2

[0209] Since there is no easy-to-use Hspg2 antibody on the market, in order to study the function of the gene, considering that the N-terminal of the Hspg2 protein has a signal peptide, a 3×flag sequence was inserted into the C-terminal of the Hspg2 endogenous genome of the orphan and haploid embryonic stem cells, And Hspg2-KI-Flag heterozygous mice were obtained by ICAHCI injection.

[0210] Hspg2-C-Flag sgRNA sequence (SEQ ID NO:57): TCATAGGCACCCACCTGCCT

[0211] Hspg2-C-Flag left and right homology arm amplification primer sequences:

[0212] Hspg2-gC-F (SEQ ID NO: 58): GTCCTAATGTGGCGGTCAAC

[0213] Hspg2-gC-R (SEQ ID NO:59):ACCTCTTCCAGTCCCCCTTGTC

[0214] Hspg2-KI-Flag heterozygous mouse embryos were taken at embryonic stage E15.5 days, and protein electrophoresis was performed on whole embryo samples to detect the expression of Hspg2-Flag. The results showed that the C-terminal labelin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, which relates to the field of biology, provides a high-throughput protein analysis method and an applicable library thereof. According to the high-throughput protein analysis method, alabeled semi-cloned mouse library is employed and one or more tagged protein antibodies are used for carrying out parallel indication analysis on a plurality of different interested target proteins. In the labeled semi-cloned mouse library, all semi-cloned mice are semi-cloned mice obtained by injecting ova by using androgenic haploid embryonic stem cells and then carrying out cultivation or sexually propagated progenies. The androgenic haploid embryonic stem cells contain genes expressing fusion proteins of the interested target proteins and labeled proteins; and the semi-cloned mice can express the fusion proteins of the interested target proteins and labeled proteins. Therefore, a system for high-throughput in-vivo real-time dynamic studies is provided for the study of biological macromolecules.

Description

technical field [0001] The invention relates to the field of biology, in particular to the field of proteomics research, in particular to a high-throughput protein analysis method and an applicable library thereof. Background technique [0002] At present, more than 26,000 functional genes encoding proteins have been discovered and mapped through the Human Genome Project, of which 42% of the genes still have no known function. Among the known genes, enzymes account for 10.28%, nucleases account for 7.5%, and signal transduction accounts for 10.28%. 12.2%, transcription factors 6.0%, signaling molecules 1.2%, receptor molecules 5.3%, selective regulatory molecules 3.2%, etc. Discovering and understanding the functions of these functional genes is of great significance for understanding life and screening new drugs. In the study of protein function, the preparation of corresponding antibodies has become an essential work, but the acquisition of antibodies has the following pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/68C40B50/06
CPCC40B50/06G01N33/6842G01N2570/00C12N15/1086C12Q1/68G01N33/68C12N5/0603C12N15/1093C12N15/85G01N33/6803
Inventor 李劲松蒋婧白梅竹晏萌康俊炎李林李党生
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI