Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving expression quantity of polypeptide lunasin in soybean

An expression, soybean technology, applied in the field of genetic engineering, can solve the problems of high cost and low Lunasin content

Inactive Publication Date: 2019-08-16
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have found that the content of Lunasin in natural raw materials is low, and the cost of obtaining Lunasin simply from natural raw materials, such as extraction, separation and purification, is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving expression quantity of polypeptide lunasin in soybean
  • Method for improving expression quantity of polypeptide lunasin in soybean
  • Method for improving expression quantity of polypeptide lunasin in soybean

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] 1. Soybean lunasin gene cloning and plant expression vector construction

[0059] Extract RNA from fresh soybean tissue, reverse transcribe cDNA, use cDNA as a template, and use Iun-F:CGAGCTCATGTCCAAATGGCAGCACCAGC and Iun-R:GGGGT ACCTCAG TCGTCGTCATCATC as upstream and downstream primers for PCR amplification, and PCR products are subjected to agarose gel electrophoresis to obtain lunasin Gene fragments, the target fragments were recovered, and connected to the T vector; the obtained recombinant plasmids were transformed into E. coli competent cells, and then sequenced and verified; digested and ligated, and the lunasin gene fragments in the cloning vector were ligated into the DTS1001 expression vector and ligated The product was transformed into Escherichia coli competent cells; the recombinant plasmid was verified by enzyme digestion and sequenced.

[0060] 2. Agrobacterium electric shock transformation and soybean genetic transformation, transfer lunasin gene into so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving expression quantity of polypeptide lunasin in soybean. The method comprises the following steps of 1) construction of soybean lunasin gene cloning and plant expression vectors and 2) soybean genetic transformation. Specifically, the method comprises, firstly, extracting RNA (ribonucleic acids) of soybean and performing cDNA (complementary deoxyribonucleic acids) inverse transcription, performing agarose gel electrophoresis on products to obtain a lunasin gene segment, and recovering and connecting a target segment onto the plasmid of the expression vector; secondly, performing electroporation agrobacterium-mediated transformation on the recombinant plasmid, and by the aid of the T-DNA (transfer DNA) region of agrobacterium, transferring targetgenes into the genome of soybean; lastly, extracting the genome of soybean, performing PCR (polymerase chain reaction) identification to verify positive transgenic soybean, and performing gel extraction for sequencing. The obtained lunasin-transferred soybean enables overexpression of the lunasin genes in soybean, significantly increases the expression quantity of the polypeptide lunasin and enhances activity of the polypeptide lunasin and accordingly can be further applied to development of functional foods.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for increasing the expression level of lunasin polypeptide in soybean and its application in functional food. Background technique [0002] Lunasin is a polypeptide compound containing 43 amino acids isolated from soybeans, which has anti-cancer, anti-inflammatory, anti-oxidative and cholesterol-lowering properties. Studies have found that the content of Lunasin in natural raw materials is low, and the cost of obtaining Lunasin simply by extracting, separating and purifying from natural raw materials is relatively high. In view of its important practical value, how to efficiently obtain Lunasin in large quantities is a difficult problem to be overcome. [0003] With the continuous development of biotechnology, genetic engineering and plant genetic transformation technology make this idea possible. The lunasin gene is integrated into the soybean genome, and t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00A01H6/54C07K14/415C07K1/14C07K1/34A23L33/18A23J3/16
CPCA23J3/16A23L33/18A23V2002/00C07K14/415C12N15/8257A23V2200/308A23V2200/30A23V2250/55A23V2300/14A23V2300/38
Inventor 任贵兴郝宇琼范鑫
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com