A method for directed editing of aroma genes in the rice sex cell genome
A fragrance gene and genome technology, which is applied in the field of targeted editing of rice sex cell genome fragrance gene, can solve the problems that hinder the successful introduction and integration of foreign genes, and hinder the entry of nanocarriers into cells, so as to shorten the gene editing breeding cycle, and the method is simple and feasible Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0041] Query the CDS sequence of the Fgr gene (LOC_Os08g32870) at the China Rice Data Center (http: / / www.ricedata.cn / ), and design two targets using CRISPR-GE (http: / / skl.scau.edu.cn / ) software point. Both targets are located on exon 2 of the Fgr gene, such as figure 1 As shown, and named as T1 and T2 respectively, the target sequence is as follows:
[0042] T1: 5’—GCGGAGGTACTTGGCCCGGACGG—3’
[0043] T2: 5’—CAAGTACCTCCGCGCAATCGCGG—3’
[0044]Using the pGRT plasmid as a template, design primers L5AD5-F, L3AD5-R, Fgr-T1-F, Fgr-T1-R, Fgr-T2-F, Fgr-T2-R, as shown in Table 1, respectively amplified Partial fragments of tRNA-T-gRNA, the sequences of which are shown in SEQ ID No.3, SEQIDNo.4, and SEQ ID No.5. After the gel recovery of each fragment, the 393bp recombinant target fragment tRNA-T1-gRNA-tRNA was assembled by Gibson assembly - T2-gRNA, as shown in SEQ ID No.6. After PCR amplification with recombinant primers Recom-f and Recom-r shown in Table 1, gel electrophoresis w...
Embodiment 2
[0048] Poly MAG1000 magnetic nanoparticles MNP and recombinant carrier were mixed according to 1:1, 1:4, 1:8, 1:16, 1:24, 1:40, 1:50 MNP / DNA mass ratio, and the DNA amount was fixed at 4 μg. Incubate at 37°C for 30 min, and ligate to prepare the complex.
[0049] The prepared complex sample was added to 1 ul of DNA dye GelRed, mixed evenly, and then spotted on agarose gel with a concentration of 0.8%, in TAE buffer solution, at a voltage of 130V, for 30min. After the electrophoresis, observe on a gel imager (Tanon 2500R), and analyze the gene loading capacity of the nanocarriers, the results are as follows: Figure 4 As shown in the figure, it can be seen that DNA and MNP are completely combined when the mass ratio of MNP / DNA is 1:1, 1:4, 1:8, and 1:16. Similarly, the above samples were digested with DNase I at 37°C for 4 hours, then electrophoresed and run on the gel to analyze the ability of nanocarriers to protect genes. The results are as follows: Figure 5 As shown, it ...
Embodiment 3
[0051] Dilute magnetic nano-MNP and MNP / DNA complexes prepared with mass ratios of 1:1, 1:4, and 1:8 with ultrapure water to 0.001 μg / μL, and analyze them with a nanoparticle size and Zeta potential analyzer (Mastersizer 3000). Particle size distribution and Zeta potential, the results are as follows Image 6 shown.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More