PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis
A technology of Proteus mirabilis and detection kits, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of low detection sensitivity, hidden safety hazards, cumbersome operation, etc., and achieve high sensitivity, The effect of reducing workload and simplifying the process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1 detects the PCR primer group of Proteus and Proteus mirabilis
[0030] The embodiment of the present invention will Proteus (Proteus), mirabilis (Proteus mirabilis) and 10 kinds of non-target bacteria (Escherichia coli, Listeria monocytogenes, Sakae bacillus, Vibrio cholerae, Vibrio vulnificus, Vibrio river , Vibrio parahaemolyticus, Staphylococcus aureus, Campylobacter jejuni, and Salmonella) were compared, and finally the specific gene of Proteus was determined to be atpD gene, and the specific gene of Proteus mirabilis was ureC gene.
[0031] Further, in the target region of Proteus and Proteus mirabilis, through the primer design principles and a variety of computer programs, the PCR primer sets of Proteus and Proteus mirabilis were designed, and a large number of experiments were screened to ensure that the intraspecific Conservative and guaranteed interspecies-specific primer sequences, including 2 groups, the nucleotide sequences of which are as foll...
Embodiment 2
[0040] Embodiment 2 detects the PCR detection kit of Proteus and Proteus mirabilis
[0041] The embodiment of the present invention provides a PCR detection kit for detecting Proteus and Proteus mirabilis, which includes the following components:
[0042] 1) Contain the primer set in Example 1;
[0043] 2) Detection probe: the probe sequence is as follows:
[0044] SEQ ID NO: 5 ACAGTTAAAGTTCAGCAGGCGGTGGTAT,
[0045] SEQ ID NO: 6 TACCCCACAGTCCCGGTATTTGGAA;
[0046] Or it is the nucleotide complementary sequence of the probe sequence.
[0047] The fluorescent group labeled at the 5' end of the probe sequence is one of FAM and VIC; the quenching group labeled at the 3' end of the probe sequence is BHQ1.
[0048] 3) PCR reaction system:
[0049] Primers and probes were dissolved to 100uM and diluted to 10uM. Add 0.6uL and 0.3uL of primers, 0.3uL and 0.15uL of probes, and 1uL and 3uL of template DNA (10-100ng) into the 20uL system, respectively. qPCR SuperMix 10.0uL unchange...
Embodiment 3
[0052] Embodiment 3 detects the PCR detection method of Proteus and Proteus mirabilis
[0053] The embodiment of the present invention provides a PCR detection method for detecting Proteus and Proteus mirabilis, using the PCR detection kit established in Example 2 to detect the sample to be detected, the steps are as follows:
[0054] Obtain the template DNA of the sample to be tested:
[0055] 1. Use a 1.5ml centrifuge tube to collect 1.0-5.0E+09 cells, centrifuge at 12000rmp for 2 minutes, discard the supernatant (cell culture medium); add 180 μL of Buffer GL, 20 μL of Proteinase K (proteinase K) and 10 μL of RNaseA (10mg, mL) (ribonuclease A), fully pipette and mix, and warm in a 56°C water bath for 10 minutes; add 200μL of Buffer GB and 200μL 100% ethanol, fully pipette and mix;
[0056] 2. Place the spin column on the collection tube, transfer the solution to the spin column, centrifuge at 12000rpm for 2 minutes, and discard the filtrate.
[0057] 3. Add 500 μL of BufferW...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


