Supercharge Your Innovation With Domain-Expert AI Agents!

PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis

A technology of Proteus mirabilis and detection kits, applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of low detection sensitivity, hidden safety hazards, cumbersome operation, etc., and achieve high sensitivity, The effect of reducing workload and simplifying the process

Pending Publication Date: 2019-09-20
ICDC CHINA CDC
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the embodiments of the present invention is to provide PCR primers for the detection of Proteus and Proteus mirabilis, aiming to solve the problems of cumbersome operation, long time-consuming, low detection sensitivity and potential safety hazards in the quantitative detection method of Proteus in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis
  • PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis
  • PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1 detects the PCR primer group of Proteus and Proteus mirabilis

[0030] The embodiment of the present invention will Proteus (Proteus), mirabilis (Proteus mirabilis) and 10 kinds of non-target bacteria (Escherichia coli, Listeria monocytogenes, Sakae bacillus, Vibrio cholerae, Vibrio vulnificus, Vibrio river , Vibrio parahaemolyticus, Staphylococcus aureus, Campylobacter jejuni, and Salmonella) were compared, and finally the specific gene of Proteus was determined to be atpD gene, and the specific gene of Proteus mirabilis was ureC gene.

[0031] Further, in the target region of Proteus and Proteus mirabilis, through the primer design principles and a variety of computer programs, the PCR primer sets of Proteus and Proteus mirabilis were designed, and a large number of experiments were screened to ensure that the intraspecific Conservative and guaranteed interspecies-specific primer sequences, including 2 groups, the nucleotide sequences of which are as foll...

Embodiment 2

[0040] Embodiment 2 detects the PCR detection kit of Proteus and Proteus mirabilis

[0041] The embodiment of the present invention provides a PCR detection kit for detecting Proteus and Proteus mirabilis, which includes the following components:

[0042] 1) Contain the primer set in Example 1;

[0043] 2) Detection probe: the probe sequence is as follows:

[0044] SEQ ID NO: 5 ACAGTTAAAGTTCAGCAGGCGGTGGTAT,

[0045] SEQ ID NO: 6 TACCCCACAGTCCCGGTATTTGGAA;

[0046] Or it is the nucleotide complementary sequence of the probe sequence.

[0047] The fluorescent group labeled at the 5' end of the probe sequence is one of FAM and VIC; the quenching group labeled at the 3' end of the probe sequence is BHQ1.

[0048] 3) PCR reaction system:

[0049] Primers and probes were dissolved to 100uM and diluted to 10uM. Add 0.6uL and 0.3uL of primers, 0.3uL and 0.15uL of probes, and 1uL and 3uL of template DNA (10-100ng) into the 20uL system, respectively. qPCR SuperMix 10.0uL unchange...

Embodiment 3

[0052] Embodiment 3 detects the PCR detection method of Proteus and Proteus mirabilis

[0053] The embodiment of the present invention provides a PCR detection method for detecting Proteus and Proteus mirabilis, using the PCR detection kit established in Example 2 to detect the sample to be detected, the steps are as follows:

[0054] Obtain the template DNA of the sample to be tested:

[0055] 1. Use a 1.5ml centrifuge tube to collect 1.0-5.0E+09 cells, centrifuge at 12000rmp for 2 minutes, discard the supernatant (cell culture medium); add 180 μL of Buffer GL, 20 μL of Proteinase K (proteinase K) and 10 μL of RNaseA (10mg, mL) (ribonuclease A), fully pipette and mix, and warm in a 56°C water bath for 10 minutes; add 200μL of Buffer GB and 200μL 100% ethanol, fully pipette and mix;

[0056] 2. Place the spin column on the collection tube, transfer the solution to the spin column, centrifuge at 12000rpm for 2 minutes, and discard the filtrate.

[0057] 3. Add 500 μL of BufferW...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention applies to the technical field of bacterial detection, provides a PCR primer, primer group, probe, kit and detection method for detecting Proteus and Proteus mirabilis, and discloses four PCR primer nucleotide sequences, in two pairs, for detecting Proteus and Proteus mirabilis. The kit comprising the primer group features high specificity and high sensitivity, and has a lower detection limit of 102 CFU / mL; detection results are accurate and reliable; electrophoretic detection on a target gene amplified product is not required; operating is simple; detection cycle is short; workload of operating personnel can be decreased; precise detection information can be acquired in time; the process of detecting Proteus species is simplified greatly; the detection cycle is shortened; the detection method may act as a primary screening means of sensitivity; positive rate of Proteus species cultivation and detection is increased; forcible technical support can be provided for China to formulate hygiene indexes for Proteus species in food in future.

Description

technical field [0001] The invention belongs to the technical field of bacteria detection, and in particular relates to a PCR primer, a primer set, a probe, a kit thereof and a detection method for detecting Proteus and Proteus mirabilis. Background technique [0002] Proteus is a non-encapsulated, non-spore-forming, gram-negative bacillus with flagella and pili. It is widely distributed in nature, animal feces, clinical specimens, and the intestinal tract of humans and animals. It is an important cause of human and animal infections. Conditional pathogens. In recent years, the prevalence of Proteus infection has continued to expand. According to the statistical results of food poisoning caused by Proteus reported in relevant literature, it is shown that food poisoning caused by Proteus in my country is on the rise year by year. In addition to causing food poisoning, Proteus can also cause a variety of infections, such as respiratory tract infection, urinary tract infectio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6851C12Q2531/113C12Q2563/107
Inventor 张茂俊岳苑顾一心
Owner ICDC CHINA CDC
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More