Application of bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid

A technology of bacillus and bacillus licheniformis, applied in the field of genetic engineering and microorganisms, to achieve the effect of increasing the utilization rate of glycerol and increasing the yield

Active Publication Date: 2019-10-08
HUBEI UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] There are currently no studies on the association of rex with poly-γ-glutamic acid in Bacillus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid
  • Application of bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid
  • Application of bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Construction of Bacillus licheniformis rex Knockout Vector

[0032] Step 1: according to the upstream and downstream sequences of the rex gene (the protein encoded by this gene is shown in SEQ ID NO.3) in the bacillus licheniformis WX-02 genome DNA sequence, design the upstream homology arm primers (A-F and A-R), downstream homology arm primers (B-F and B-R); and using the genomic DNA of Bacillus licheniformis WX-02 as a template, carry out PCR amplification with the upstream homology arm primer and downstream homology arm primer of rex gene respectively to obtain rex The upstream homology arm of the gene (508bp, shown in SEQ ID NO.1) and the downstream homology arm of the rex gene (497bp, shown in SEQ ID NO.2);

[0033] Among them, the sequence of A-F, A-R, B-F, B-R is:

[0034] A-F: CGGGATCCGAATGAGTTTACACATTTTAATGA,

[0035] A-R: ATTTATTTTTCGTTTTCCGTTAAACTAATCCTCCATGTCTA,

[0036] B-F: TAGACATGGAGGATTAGTTTAACGGAAAACGAAAAATAAAT,

[0037] B-R: GCTCTAGAAAGCCCACAGCTGG...

Embodiment 2

[0044] Construction of rex knockout strains:

[0045] Step 1: Transform the integrated expression vector T2(2)-rex into Bacillus licheniformis WX-02, screen under the condition of 37°C and contain kanapenicillin resistance, and screen to obtain transformants, transformants Pick the plasmid for colony PCR verification (the primers used are: T2-F and T2-R). If the PCR verification result of the transformant is: an electrophoretic band occurs at 1323bp, it proves that the integrated expression vector T2(2)-rex is successfully transferred into Bacillus licheniformis WX-02, at this time, the transformant is a positive transformant ( That is, the Bacillus licheniformis WX-02 that has been transformed into the integrated expression vector T2(2)-rex);

[0046] Step 2: Transplant the positive transformants obtained in step 1 at 45°C on a medium containing kanapenicillin resistance for 3 times, each time for 12 hours, and use T2-F and rex-YR as primers Colony PCR detection of single e...

Embodiment 3

[0052] Application of Bacillus licheniformis WX-02△rex in high-yield poly-γ-glutamic acid:

[0053] 1) Seed fermentation: Activate Bacillus licheniformis WX-02 and Bacillus licheniformis WX-02△rex on the plate, pick the bacteria and inoculate them into 250mL Erlenmeyer flasks containing 50mL liquid LB respectively, and culture at 37°C and 230rpm for 10h. Then subsequently inoculate into the fermentation medium with an inoculum of 1% (volume ratio), and 50ml of fermentation medium is packed in a 250mL Erlenmeyer flask.

[0054] Described fermentation medium applicant has selected 9 kinds of culture medium formulas, numbering 1-9 is poly-gamma-glutamic acid fermentation culture medium (table 1), in addition, all comprises hydrogen phosphate dihydrogen phosphate in every culture medium Potassium 0.5g / L, calcium chloride 0.5g / L, magnesium sulfate 0.5g / L, ferric chloride 0.004g / L, manganese sulfate 0.5g / L.

[0055] Table 1 Medium formula for γ-PGA fermentation

[0056]

[0057...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the technical field of genetic engineering and microorganisms, and particularly relates to an application of a bacillus licheniformis rex gene to increase of yield of poly gamma-glutamic acid. A molecular biology technique is adopted, a transcription inhibition factor gene rex is knocked out in bacillus licheniformis, a bacillus licheniformis engineering strain WX-02 Deltarex having rex deletion is obtained, and the glycerine metabolism rate of the bacillus licheniformis is notably increased. The glycerine consumption rate of the WX-02 Delta rex in different culture mediums is at least increased by 10.55% than that in an original bacterium namely bacillus licheniformis WX-02, and the highest glycerine consumption rate can reach 27.94%. Through the adoption of thestrain in the poly gamma-glutamic acid fermentation culture mediums, the yield of the poly gamma-glutamic acid can be notably increased, the yield is at least increased by 35.29%, and the yield can beat most increased by 50%, which illustrates that a genetic engineering reformation method has important effects in increasing the microorganism glycerine metabolism rate, and the efficiency of synthesizing biological based chemicals through glycerine can be improved.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and microbes, and in particular relates to the application of bacillus rex gene in improving the yield of poly-γ-glutamic acid. Background technique [0002] Poly-γ-glutamic acid (γ-PGA), also known as natto gum and poly-γ-glutamic acid, is a biopolymer produced by microbial fermentation, mainly composed of L-glutamic acid And (or) D-glutamic acid monomers are polymerized through γ-amide bonds, and the molecular weight is usually 10KD-10000KD. γ-PGA has the characteristics of good water solubility, adsorption capacity, biodegradability, and non-toxicity to the human body and the environment, and has a wide range of application values ​​in many fields. In sewage treatment, it can be used as adsorbent and flocculant; in agricultural field, it can be used as water retention agent, fertilizer enhancer and synergist. Because γ-PGA has good economic value and wide application prospect, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/02C12N1/21C12R1/10
CPCC07K14/32C12P13/02
Inventor 陈守文占杨杨周梦林马昕李鑫
Owner HUBEI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap