Three scFv antibodies and encoding genes thereof and application of scFv antibodies in preparing preparations for treating or preventing O-type foot-and-mouth disease

A coding and gene technology, applied in the field of scFv antibodies, can solve the problems of uneven quality and easy transmission of blood-borne diseases, etc., achieve good therapeutic effect, controllable production quality, and avoid the effect of horizontal transmission of diseases

Inactive Publication Date: 2019-10-11
NORTHEAST AGRICULTURAL UNIVERSITY
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these two types of antiserum have experienced severe allergic side effects during clinical use, requiring emergency injections of epinephrine to relieve symptoms
Because blood products have defects such as uneven quality and easy transmission of blood-borne diseases, genetically engineered recombinant antibodies can effectively solve the problems of traditional hyperimmune serum, and will provide a safer, more effective and more standardized method for the prevention and treatment of this disease. Passive Immunization

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Three scFv antibodies and encoding genes thereof and application of scFv antibodies in preparing preparations for treating or preventing O-type foot-and-mouth disease
  • Three scFv antibodies and encoding genes thereof and application of scFv antibodies in preparing preparations for treating or preventing O-type foot-and-mouth disease
  • Three scFv antibodies and encoding genes thereof and application of scFv antibodies in preparing preparations for treating or preventing O-type foot-and-mouth disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1: Discovery of scFv antibody (single-chain antibody) and its coding gene

[0046] 1. Construction of antibody library

[0047] The pigs immunized with FMD VP1 virus particles were tested for their antibody titers by FMD O-type liquid phase blocking ELISA antibody detection kit. The pig spleen with the highest antibody titer (1:256) was used to extract total RNA from the spleen tissue by Trizol method . Refer to the porcine antibody gene sequence registered in GenBank, compare and analyze the sequence, design primers for the amplification of the variable regions of the heavy chain and light chain of the porcine antibody library, and insert Sfi I and Hind III into the upstream of the heavy chain in sequence Insert the NheI restriction site downstream; insert the BamH I restriction site upstream of the light chain, and insert Xho I and Sfi I restriction sites downstream in turn. The VH and VL fragments were respectively inserted into the upstream and downstream ...

Embodiment 2

[0057] Embodiment 2, preparation of scFv antibody

[0058] 1. Using the plasmids pBSD-scFv-29, pBSD-scFv-45, and pBSD-scFv-116, which have been proved to be positive clones by FACS, as templates, design primers to clone the three strains of scFv. The upstream and downstream primers for cloning scFv-29 are P3 and P4 respectively; the upstream and downstream primers for cloning scFv-45 are P5 and P6 respectively; the upstream and downstream primers for cloning scFv-116 are P7 and P8 respectively; the upstream primers are all introduced into Nde I, the downstream primers are introduced into the Xho I restriction site, synthesized by Shanghai Sangon Sequencing Company. The scFv gene sequence is amplified by PCR, and the PCR amplified product is separated by nucleic acid electrophoresis.

[0059] The restriction endonuclease Nde I site is marked with an underline, and the Xho I restriction site is marked with a wavy line:

[0060] scFv-29 primer:

[0061] P3: CATATGATGAAGCTTGGGT...

Embodiment 3

[0074] Embodiment 3, the preparation of VP1 protein

[0075] 1. Construction of recombinant plasmids

[0076] 1. Synthesize the FMDV VP1 double-stranded DNA molecule shown in sequence 7 of the sequence listing.

[0077] 2. Using the double-stranded DNA molecule synthesized in the step as a template, the primers composed of P1 and P2 are used to perform PCR amplification on vp1 to obtain a PCR amplification product.

[0078] The restriction endonuclease BamH I site is underlined, the Bsa I restriction site is double underlined, and the FLAG sequence is obliquely bolded and marked with wavy lines:

[0079] P1: GGTCTCTAGG TATGACCACTTCGACGGGCGAGT

[0080] P2:

[0081] 3. The PCR amplified product of step 2 was double-digested with restriction endonucleases BsaI and BamHI, and the digested product was recovered.

[0082] 4. Digest the plasmid pHisSUMO with restriction endonucleases BsaI and BamHI to recover a vector backbone of about 5700 bp.

[0083] 5. Ligate the digeste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses three scFv antibodies and encoding genes thereof and application of the scFv antibodies in preparing preparations for treating or preventing an O-type foot-and-mouth disease. Three single-chain antibodies, namely scFv antibodies are provided; the scFv antibodies have the capability of specifically binding to FMDV structural protein 1 (VP1) and O-type FMDV toxic strains. Byadopting the swine-origin scFv antibodies, defects can be overcome that when an immune serum and an egg yolk antibody are in use, preparation is complicated, the production cost is high, effects are unstable, the quality during industrial production is difficult to control, and horizontally transmitted diseases are caused. The swine-origin scFv antibodies have the advantages of being high in specificity, controllable in quality during industrial production, and the like; the problems of the horizontally transmitted diseases and anaphylactic reaction which are caused by the immune serum are avoided.

Description

technical field [0001] The present invention relates to three kinds of scFv antibodies, their encoding genes and their application in preparing preparations for treating or preventing type O foot-and-mouth disease. Background technique [0002] Foot-and-mouth disease is an acute, febrile, highly contagious disease caused by Foot and Mouth Disease Virus (FMDV). The disease is a severe infectious disease of cloven-hoofed animals, which can spread quickly and long distances, and there are as many as 70 susceptible animals. The World Organization for Animal Health (International Office of Epizootics, OIE) listed the disease as the first class A infectious disease. At present, the foot-and-mouth disease prevalent in my country is mainly type O. In addition to active immunization preparations such as conventional inactivated vaccines and synthetic peptide vaccines, type O FMDV antiserum is also one of the main prevention and control measures. At present, there are two main types...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10C12N15/13G01N33/569A61K39/135A61P31/14
CPCA61K2039/505A61P31/14C07K16/1009C07K2317/56C07K2317/622G01N33/56983G01N2333/09
Inventor尹杰超任桂萍李德山李青青胡爽孟婧刘铭瑶
OwnerNORTHEAST AGRICULTURAL UNIVERSITY