Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

XPO1 gene knockout pancreatic cancer cell line and construction method thereof

A technology of pancreatic cancer cells and construction methods, applied in the direction of microbial-based methods, tumor/cancer cells, and other methods of inserting foreign genetic materials, which can solve the problems of high off-target rate, unknown curative effect, and unstable gene knockout efficiency and other issues to achieve the effect of improving regulation efficiency

Pending Publication Date: 2019-10-18
SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Artificially synthesized specific XPO1 inhibitors such as CBS9106, KPT-115, KPT-127, KPT-185, KPT-330, etc., have been carried out in phase I / I clinical trials in hematological tumors and some solid tumors, and have achieved certain results. clinical efficacy, but the treatment can also cause side effects such as weight loss, anorexia, and fatigue, so its usage is limited
[0008] The above target gene interference technology belongs to post-transcriptional regulation, which has the defects of high off-target rate and unstable gene knockout efficiency
However, the curative effect of XPO1 inhibitors is yet to be observed, and there are certain adverse reactions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • XPO1 gene knockout pancreatic cancer cell line and construction method thereof
  • XPO1 gene knockout pancreatic cancer cell line and construction method thereof
  • XPO1 gene knockout pancreatic cancer cell line and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Description of the experimental process: Aiming at the target gene sequence of the target gene, the sgRNA interference target sequence is designed, and a single-stranded DNA oligo is synthesized by a special primer synthesis company. Enter the Lenti-CAS9-sgRNA-tag vector (element sequence: U6-sgRNA-EF1a-Cas9-FLAG-P2A-puro). The ligated product was competently transformed with TOP10, and the colony PCR was positively cloned and then sequenced to obtain an overexpression lentiviral plasmid expressing sgRNA with the correct sequence.

[0034] The sgRNA sequence is as follows: sgRNA: GGATTATGTGAACAGAAAAG (SEQ ID NO.1).

[0035] Synthetic oligo information is shown in Table 1 below:

[0036] Table 1

[0037] No. 5’ STEM 3’ XPO1-sgRNA-a CACCg GGATTATGTGAACAGAAAAG XPO1-sgRNA-b aaac CTTTTCTGTTCACATAATCC c

[0038] The experimental steps are as follows:

[0039] 1. sgRNA design and synthesis

[0040] Find the sequence of the human XPO1...

Embodiment 2

[0072] Example 2 Western blots detection of XPO1 knockout cells obtained in Example 1

[0073] The experimental steps are as follows:

[0074] 1. Protein heating and denaturation treatment: prepare a 1.5ml clean EP tube, draw an equal mass of protein (100ug) according to the protein concentration, and the volume of each tube is 100ul, fill up the final volume of each group of proteins with RIPA solution, add 1 / 5 Mix the final volume of 5×SDS-PAGE loading buffer evenly, denature the protein in a metal bath at 98°C for 10 minutes, take out the protein and put it on ice, centrifuge briefly, cool to room temperature, load directly or store at -20 ℃.

[0075] 2. Gel preparation: prepare 10% separating gel and 5% stacking gel, see materials section for configuration method. Put it in the waste electrophoresis solution (see the material section for the preparation method) overnight at 4°C.

[0076] 3. Sample loading: 20ul protein solution per well, add 5ul and 3ul pre-stained mark...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses an sgRNA for knocking out an XPO1 gene, and a base sequence is: 5'-GGATTATGTGAACAGAAAAG-3'; the invention also discloses an XPO1 gene knockout pancreatic cancer cell line, wherein the XPO1 gene sequence lacks two adjacent thymines as compared with a wild type, as shown in a graph 4; and a method of constructing a pancreatic cancer cell line in which the XPO1 gene isknocked out. The pancreatic cancer cell line constructed by the invention regulates the expression of the target gene XPO1 from a genomic layer, compared with the traditional methods, the traditionalmethods mainly focus on the regulation of the transcription level, the method can regulate the target gene XPO1 at multiple levels, and significantly improves the regulation efficiency of the XPO1 gene.

Description

technical field [0001] The invention relates to the technical field of gene knockout, in particular to an XPO1 gene knockout pancreatic cancer cell line and a construction method thereof. Background technique [0002] Pancreatic cancer is one of the most common gastrointestinal tumors, and its morbidity and mortality are increasing year by year worldwide. The complexity of the pathogenesis of pancreatic cancer and the lack of effective early diagnosis methods increase the difficulty of the treatment of pancreatic cancer. The nuclear-to-cytoplasmic transport of mRNA and specific proteins is a key step in the regulation of intracellular signals and participates in life activities such as cell proliferation and apoptosis. XPO1 / CRM1 (exportin 1 / chromosome region maintenance 1) is an important member of the nuclear export family importin β family, and is one of the important mediators involved in nucleoplasmic transport, and can specifically recognize nuclear export sequence (nu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/867C12N15/90C12N5/10C12R1/91
CPCC12N15/113C12N15/86C12N15/907C12N5/0693C07K14/47C12N2310/10C12N2310/20C12N2740/15043
Inventor 张世能黄凤婷李苑华黄娴娴庄燕妍
Owner SUN YAT SEN MEMORIAL HOSPITAL SUN YAT SEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com