Cyclic tumor cell detection method
A tumor cell and cell technology, applied in the field of cell detection, can solve the problems of low enrichment efficiency, inconvenient use, and high technical difficulty, and achieve the effects of improving sensitivity and specificity, improving recognition accuracy, and great application value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0109] Example 1: Detection and analysis of mock samples of healthy human peripheral blood mixed with tumor cell lines
[0110] In this embodiment, HepG2 cells mixed with gradient dilution are used in the peripheral blood of healthy people, and it is detected and analyzed as a simulated sample to evaluate the efficiency of this method in detecting tumors, that is, the recovery rate performance of this method. The specific details are as follows:
[0111] (1) Sample preparation
[0112] Digest the HepG2 cells in the culture dish and make a single-cell suspension, count them with a red blood cell counting board, dilute them to an appropriate concentration with PBS, carefully draw a certain number of tumor cells with a pipette, and add 5ml of anticoagulant healthy people In peripheral blood, ensure quantitative accuracy.
[0113] (2) Specimen collection and pretreatment
[0114] The human peripheral blood sample was added with buffer solution and then centrifuged for 5-10 minut...
Embodiment 2
[0133] Example 2: CTC detection of clinical liver cancer blood samples
[0134] (1) Sample preparation
[0135] A total of 83 cases of liver cancer were clinically diagnosed in this group, of which 52 cases obtained histological diagnosis. A total of 124 peripheral blood samples were collected.
[0136] (2) Sample detection
[0137] Gently invert 7.5 ml of the above blood sample several times to mix well, and then follow the steps in Example 1 to detect the number of circulating tumor cells. We chose AFP as the specific marker of liver cancer, and designed the primer sequences as follows:
[0138] HCC AFP
[0139] GSS_F sequence (3'-5'): CCGTCGTAAAGAGGTTGTCC (SEQ ID NO: 1)
[0140] GSS_R sequence (3'-5'): CGACGAAACCCTCAAATT (SEQ ID NO:2)
[0141] ID1 (3'-5'): ATCATG (SEQ ID NO: 3)
[0142] ID2 (3'-5'): TCTGAC (SEQ ID NO: 4)
[0143] G_R (3'-5'): GGCGACTTGGCGCACA (SEQ ID NO: 5)
[0144] G_F (3'-5'): GGTTACTGGGCTGCCT (SEQ ID NO: 6)
[0145] (3) Analysis of test results...
Embodiment 3
[0169] Example 3: Prostate cancer CTC cells undergoing EMT transformation
[0170]Studies have found that CTCs can undergo epithelial-mesenchymal transition (EMT) behavior. EMT causes CTCs to lose the phenotype of epithelial cells, acquire some phenotypes of mesenchymal cells, and exhibit stronger deformation and movement capabilities, so that they have the ability to invade through the surrounding basement membrane, make cells lose intercellular adhesion, and assist CTCs Entering the blood system, these tumor cells with high vitality and high metastatic potential survive in the circulatory system, aggregate with each other to form tiny tumor thrombi, and develop into metastases under certain conditions. Researchers believe that 2.5% of CTCs can lead to micrometastases, which eventually cause cancer recurrence or even death in patients. However, the number of such CTC cells is extremely small and difficult to capture.
[0171] (1) Sample preparation
[0172] This patent col...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



