Cyclic tumor cell detection method

A tumor cell and cell technology, applied in the field of cell detection, can solve the problems of low enrichment efficiency, inconvenient use, and high technical difficulty, and achieve the effects of improving sensitivity and specificity, improving recognition accuracy, and great application value

A tumor cell and cell technology, applied in the field of cell detection, can solve the problems of low enrichment efficiency, inconvenient use, and high technical difficulty, and achieve the effects of improving sensitivity and specificity, improving recognition accuracy, and great application value

CN110456034AActive Publication Date: 2019-11-15ZHIHUI MEDICAL TECH (SHANGHAI) CO LTD

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyclic tumor cell detection method
  • Cyclic tumor cell detection method
  • Cyclic tumor cell detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] Example 1: Detection and analysis of mock samples of healthy human peripheral blood mixed with tumor cell lines

[0110] In this embodiment, HepG2 cells mixed with gradient dilution are used in the peripheral blood of healthy people, and it is detected and analyzed as a simulated sample to evaluate the efficiency of this method in detecting tumors, that is, the recovery rate performance of this method. The specific details are as follows:

[0111] (1) Sample preparation

[0112] Digest the HepG2 cells in the culture dish and make a single-cell suspension, count them with a red blood cell counting board, dilute them to an appropriate concentration with PBS, carefully draw a certain number of tumor cells with a pipette, and add 5ml of anticoagulant healthy people In peripheral blood, ensure quantitative accuracy.

[0113] (2) Specimen collection and pretreatment

[0114] The human peripheral blood sample was added with buffer solution and then centrifuged for 5-10 minut...

Embodiment 2

[0133] Example 2: CTC detection of clinical liver cancer blood samples

[0134] (1) Sample preparation

[0135] A total of 83 cases of liver cancer were clinically diagnosed in this group, of which 52 cases obtained histological diagnosis. A total of 124 peripheral blood samples were collected.

[0136] (2) Sample detection

[0137] Gently invert 7.5 ml of the above blood sample several times to mix well, and then follow the steps in Example 1 to detect the number of circulating tumor cells. We chose AFP as the specific marker of liver cancer, and designed the primer sequences as follows:

[0138] HCC AFP

[0139] GSS_F sequence (3'-5'): CCGTCGTAAAGAGGTTGTCC (SEQ ID NO: 1)

[0140] GSS_R sequence (3'-5'): CGACGAAACCCTCAAATT (SEQ ID NO:2)

[0141] ID1 (3'-5'): ATCATG (SEQ ID NO: 3)

[0142] ID2 (3'-5'): TCTGAC (SEQ ID NO: 4)

[0143] G_R (3'-5'): GGCGACTTGGCGCACA (SEQ ID NO: 5)

[0144] G_F (3'-5'): GGTTACTGGGCTGCCT (SEQ ID NO: 6)

[0145] (3) Analysis of test results...

Embodiment 3

[0169] Example 3: Prostate cancer CTC cells undergoing EMT transformation

[0170]Studies have found that CTCs can undergo epithelial-mesenchymal transition (EMT) behavior. EMT causes CTCs to lose the phenotype of epithelial cells, acquire some phenotypes of mesenchymal cells, and exhibit stronger deformation and movement capabilities, so that they have the ability to invade through the surrounding basement membrane, make cells lose intercellular adhesion, and assist CTCs Entering the blood system, these tumor cells with high vitality and high metastatic potential survive in the circulatory system, aggregate with each other to form tiny tumor thrombi, and develop into metastases under certain conditions. Researchers believe that 2.5% of CTCs can lead to micrometastases, which eventually cause cancer recurrence or even death in patients. However, the number of such CTC cells is extremely small and difficult to capture.

[0171] (1) Sample preparation

[0172] This patent col...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a cyclic tumor cell detection method. The method comprises that a human body fluid sample is collected and fixed by formaldehyde to enhance the permeability of a cell membrane, cells are added to groups of PCR multiple combined tubes, each tube is added with a reverse transcription primer with ID1, after reverse transcription into cDNA molecules, the cells are collected and added into another group of PCB multiple combined tubes, each tube is added with a 3' end extension prime which carries ID2 and includes a 3' end capable of specifically recognizing cDNA molecules,extension reaction is carried out after sequential complement, the cells are collected and cracked, and the PCR prime is used to pre-amplify an extension product. The sequence is measured in high flux, and the ID1:ID2 combination manner is analyzed. The detection method has the advantages that and PCR amplification are carried out on different markers, the cyclic tumor cells and cyclic tumor cellswith EMT can be accurately identified, other technologies can be combined for use, and the extremely few cyclic tumor cells and other non-body-fluid rare cells in the body fluid sample can be detected to largest extent.

Description

technical field [0001] The present invention relates to the technical field of cell detection, in particular to a method for detecting rare cells in body fluids with high efficiency, in particular to a method for accurately detecting circulating tumor cells from blood, and the present invention also relates to a method for detecting circulating tumor cells from tumor A kit for detecting circulating tumor cells in peripheral blood of patients, as well as an analysis method and application of circulating tumor cells. Background technique [0002] Malignant tumors are one of the major diseases that seriously endanger human life and health. It is important to find methods for early diagnosis, prediction of metastasis and prognosis, and less invasive methods to improve the survival rate of such patients. In recent years, with the development of molecular biology techniques, people's understanding of the molecular mechanism of tumor occurrence and development has been gradually en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
15 Nov 2019
Publication
CN110456034A
IPC
G01N33/50
CPC
G01N33/5044; G01N33/50; C12Q1/68
Inventors
孙奋勇; 潘秋辉