Check patentability & draft patents in minutes with Patsnap Eureka AI!

Genetic engineering strain for accumulating emodin and construction method and application thereof

A technology for genetically engineered strains and emodin, applied in the field of genetic engineering, can solve problems such as inability to synthesize, a small amount of synthetic related products, and a complex biosynthetic mechanism.

Active Publication Date: 2019-12-03
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the biosynthetic mechanism of natural products is very complex, not only affected by various environmental factors, but also regulated by complex regulatory networks such as internal signal transduction, global regulation, and specific transcriptional regulation.
Therefore, under normal conditions, most of the secondary metabolite synthesis pathways are inactive, and related products cannot be synthesized or only a small amount can be synthesized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetic engineering strain for accumulating emodin and construction method and application thereof
  • Genetic engineering strain for accumulating emodin and construction method and application thereof
  • Genetic engineering strain for accumulating emodin and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1, Construction of Aspergillus terreus efficient gene targeting platform

[0063] Aspergillus terreus ATCC20542 is a strain for studying secondary metabolites. This example refers to Example 2 of the invention patent "A Method and Application of Improving the Application Efficiency of Gene Targeting Technology in Aspergillus terreus, ZL201510275491.5" to knock out soil Aspergillus ATCC20542's ku80 constructed a highly efficient gene targeting Aspergillus ATCC20542-Δku80 (ATCC20542, Δku80::ptrA), and further referred to Example 5 of the patent application to knock out the pyrG gene to construct a genetic transformation based on uracil auxotrophy The screened chassis cell strain Aspergillus ATCC20542-ΔpyrG (ATCC20542, Δku80::ptrA, ΔpyrG), except that the host bacteria was replaced by Aspergillus terreus ATCC20542, the above operation is exactly the same as the steps in the example of patent ZL201510275491.5.

Embodiment 2

[0064] Example 2. Activation of the emodin biosynthetic pathway by regulatory factor overexpression in Aspergillus terreus ATCC20542

[0065] 1) Construction of transcriptional regulators to activate DNA elements

[0066] Design and synthesize the following primers:

[0067] Uku80-F: 5'-agcacaaacatattgatcagc-3';

[0068] pyrGAn-R:5'-ggatcctcccagagtgtaagcatcaaatcgtcgtaccgca-3';

[0069] trpC-F3:5'-aagcttgagatccacttaacgttactgaaatcatc-3';

[0070] Dku80-R:5'-gaaggcgaaaagtagtctcgtg-3';

[0071] PgpdAt-F743:5'-ttacactctgggaggatccaggtac-3';

[0072] PgpdAt-R1:5'-tgtgatgattgatgagttgttg-3'.

[0073] In order to amplify the DNA sequences of the transcriptional regulators ATEG_08438, ATEG_08442, ATEG_08452 and ATEG_08453, the primers were designed as follows:

[0074] 08438-F: ACAACTCATCATCAATCATCAC ATGTCTGTCCAGAAACGCGCAC,

[0075] 08438-R: GTTAAGTGGATCTCAAGCTT CACAGACTGGCTGGTCTTGGG;

[0076] 08442-F: ACAACTCATCATCAATCATCAC ATGTTCATCACACTGAAATGTC,

[0077] 08442-R: GTTA...

Embodiment 3

[0090] Embodiment 3, the analysis of engineering strain fermentation production emodin and emodin derivatives

[0091] The engineered strain ATCC20542- OE 08438, ATCC20542- OE 08442 ATCC20542- OE 08452, ATCC20542- OE 08453 and the control strain ATCC20542-Δku80 were respectively inoculated on PDA solid plates, and cultured at 30°C for 7 days to obtain spores. The spores were respectively inoculated into 35 ml of SMP seed medium (250 mL Erlenmeyer flask), and cultured with shaking at 28° C. and 220 rpm for 48 hours. Inoculate 3.5 mL of seed liquid into 50 mL of SMP fermentation medium (250 mL Erlenmeyer flask) respectively, and culture at 28°C and 220 rpm for 8 days with shaking to obtain the fermentation liquid of each strain.

[0092]Analysis and comparison of fermented crude extracts. After fermentation, 200-mesh nylon cloth was used to separate the bacterial cells from the bacterial liquid. The bacterial cells were soaked in dichloromethane and methanol (V / V=1:1) and ul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a genetic engineering strain capable of accumulating emodin. An original strain of the genetic engineering strain is aspergillus terreus capable of producing emodin or downstream derivatives thereof, the genetic engineering strain is prepared by mutating O-methyltransferase genes (gedA) in the aspergillus terreus. Compared with the original strain, the genetic engineering strain can be used for accumulating emodin.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a genetically engineered bacterial strain capable of accumulating emodin and its construction method and application. Background technique [0002] Rhubarb is an important traditional Chinese medicine, which is used in many traditional Chinese medicine compound prescriptions, and emodin (CAS: 518-82-1) is its main active ingredient. In recent years, the research results on the biological activity of emodin and its derivatives show that it also has important potential medical value in the prevention and treatment of various diseases. In addition, emodin is also a natural pigment, which can also be used in health care and daily chemicals, such as hair care and skin care products. At present, emodin is mainly extracted from plants such as rhubarb and Polygonum cuspidatum, which have low content of active ingredients and many by-products. Moreover, planting is time-consu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12P7/26C12R1/66
CPCC12N9/1007C12P7/26
Inventor 吕雪峰黄雪年齐飞飞张伟
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More