Amine dehydrogenase and application thereof

A technology of amine dehydrogenase and amino acid dehydrogenase, applied in the direction of enzymes, oxidoreductases, enzymes, etc., can solve the problems of no catalytic activity, etc., and achieve the effect of simple equipment, high optical purity, and convenient operation of catalytic reactions

Active Publication Date: 2019-12-17
XIAMEN UNIV
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is basically no catalytic activity for the reductive amination of a series of ketones to prepare chiral amines

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amine dehydrogenase and application thereof
  • Amine dehydrogenase and application thereof
  • Amine dehydrogenase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Construct an amino acid dehydrogenase mutant with a single point mutation (G131L), and mutate the 131st amino acid. The specific steps are as follows:

[0031] (1) Introduce mutations: design primers according to the nucleotide sequence shown in SEQ ID NO.02, design upstream primers and downstream primers containing different sites, the upstream primers and downstream primers are as follows:

[0032] Upstream primer (SEQ ID NO.03): G131L-F aattgtatcgtcctcgtacccgaa

[0033] Downstream primer (SEQ ID NO.04): g131L-R gaggacgatacaattcgtttcttt

[0034] After mixing the primers and the template plasmid, high-fidelity taq polymerase KOD-Plus was added to perform PCR amplification of the whole plasmid, and the PCR product was detected by electrophoresis after the PCR was completed.

[0035] (2) Construction of a recombinant expression strain capable of expressing phenylalanine dehydrogenase with a His-tag tag: the original sequence of the phenylalanine dehydrogenase (PheDH) ge...

Embodiment 2

[0044] Construct an amino acid dehydrogenase mutant with a single point mutation (g131M), and mutate the 131st amino acid. The specific steps are as follows:

[0045] (1) Introducing mutations: design primers according to the nucleotides shown in SEQ ID NO.02 to design upstream primers and downstream primers that contain different sites, and the upstream primers and downstream primers are as follows:

[0046] Upstream primer (SEQ ID NO.05): g131M-F aattgtatcgtcatggtacccgaa

[0047] Downstream primer (SEQ ID NO.06): g131M-R catgacgatacaattcgtttcttt

[0048] After mixing the primers and the template plasmid, high-fidelity taq polymerase KOD-Plus was added to perform PCR amplification of the whole plasmid, and the PCR product was detected by electrophoresis after the PCR was completed.

[0049] (2) Construction of a recombinant expression strain capable of expressing phenylalanine dehydrogenase with a His-tag tag: the original sequence of the phenylalanine dehydrogenase (PheDH) ...

Embodiment 3

[0055] Construct the amino acid dehydrogenase mutant of a single point mutation (N262V), and mutate the 262-position amino acid residue. The specific steps are as follows:

[0056] (1) Introduce mutations: design primers according to the nucleotides shown in SEQ ID NO.02, design upstream primers and downstream primers containing different sites, the upstream primers and downstream primers are as follows:

[0057] Upstream primer (SEQ ID NO.07): N262V-F gtaggaagtgccgtcaatcagctc

[0058] Downstream primer (SEQ ID NO.08): N262V-R gacggcacttcctacgatcgcttt

[0059] After mixing the primers and the template plasmid, high-fidelity taq polymerase KOD-Plus was added to perform PCR amplification of the whole plasmid, and the PCR product was detected by electrophoresis after the PCR was completed.

[0060] (2) Construction of a recombinant expression strain capable of expressing phenylalanine dehydrogenase with a His-tag tag: the original sequence of the phenylalanine dehydrogenase (Phe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses amine dehydrogenase and application thereof. The amine dehydrogenase is obtained by conducting mutation on amino acid dehydrogenase shown as SEQ ID NO.01, and mutation comprises at least one of the following: G at a 131<st> location is mutated into L or M, N at a 262<nd> location is mutated into V or L, Y at a 285 location is mutated into L or M, and M at a 333<rd> location is mutated into D. A catalytic reaction of the amine dehydrogenase is convenient to operate, the amine dehydrogenase has the advantages of high product optical purity, high yield and the like, equipment is simple, and the amine dehydrogenase has good industrial application prospects in the field of preparation of chiral amine through biological catalysis and high-value development of marine biological resources.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an amine dehydrogenase and an application thereof. Background technique [0002] Chiral amines are the structural units of many bioactive molecules, and are important chiral building blocks in medicine and fine chemicals. About 40% of optically active drugs contain chiral amine structures. The high-efficiency preparation technology of chiral amine is the key technology in the development of chiral drug field. In the prior art, the chemical preparation methods of chiral amines mainly include the reduction of amino acids or their derivatives, the coupling of aldehydes or ketones with imines, and the amination and ring opening of epoxy compounds. The catalytic efficiency of these chemical preparation methods is low And it is easy to cause environmental pollution. Therefore, efficient biocatalysis is an important way to solve the problems of chiral amine pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/06C12P13/00
CPCC12N9/0014C12P13/001C12Y104/99003
Inventor王世珍霍鹤宇韩雨珑
OwnerXIAMEN UNIV