Envelope protein trimer immunogen capable of inducing HIV-1 broad spectrum and neutralizing antibody and application thereof

A technology of HIV-1 and envelope protein, applied in the field of biomedicine, can solve the problems of complex bnAb evolution mechanism and lack of mature experimental evidence, and achieve good immune results

Active Publication Date: 2019-12-31
JILIN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the complexity of the bnAb evolution mechanism, this strategy still lacks mature solutions and sufficient experimental evidence

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Envelope protein trimer immunogen capable of inducing HIV-1 broad spectrum and neutralizing antibody and application thereof
  • Envelope protein trimer immunogen capable of inducing HIV-1 broad spectrum and neutralizing antibody and application thereof
  • Envelope protein trimer immunogen capable of inducing HIV-1 broad spectrum and neutralizing antibody and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1 Env consensus gene sequence design

[0021] 1. Obtain aligned sequences from the HIV sequence database (each sequence comes from an infected person)

[0022] 2. Delete the same sequence

[0023] 3. Delete sequences with more than 10 ambiguous bases

[0024] 4. Use Seaview software to manually adjust and prepare the optimal sequence alignment

[0025] 5. Determine the dominant nucleotide (>50%) for each position using the online tool with a 50% threshold. If some sites cannot determine the dominant nucleotide (50% or the highest dominant nucleotide <50%), then reduce the percentage of the threshold to obtain a clear dominant nucleotide (http: / / www.hiv.lanl .gov / content / sequence / CONSENSUS / AdvCon.html).

[0026] 6. Manually adjust according to the following rules to obtain the final consensus gene sequence:

[0027] a. Main rule: Most nucleotides in the four CRF / subtypes were selected as the consensus gene sequence. CRF07_BC (35.5%), CRF01_AE (27.6%), CRF08...

Embodiment 2

[0029] Embodiment 2 Antigen protein expression vector construction

[0030] This program uses the pTT5 plasmid as the expression vector. Using the 718B.con Env gene sequence as a template, gp120con was amplified by PCR. At the same time, the fragments of gp120AE, tPA, Protan and MTQ were amplified using the plasmids stored in the laboratory as templates, and the homologous recombination kit was used to perform homologous recombination to obtain pTT5-tPA-Protan-gp120con-MTQ, pTT5-tPA-Protan- Antigen protein expression vectors such as gp120AE-MTQ and pTT5-tPA-gp120con-MTQ.

[0031] (1) Primer design:

[0032] tPA-F:CTGGCTAGCGTTTAAACTTAAGCTTGCCACCATGGATGCAATGAAGAGA

[0033] tPA-R: GCGGGTTTAAACGGGCCCCTTAGACTCGAGGGTACCGCTGGGCGAAACGAAGAC

[0034] Protan-F: CACTGGGCATCGCCCCAACTGGATCCGGTGGTGGT

[0035] Protan-R: GTTTAAACGGGCCCCTTAGACTCGAGTTATTTAATACGCA

[0036] gp120-F:AGTTTAAACGGATCTCTAGCGAATTCGCCACCATGGATGCAATGAAGAG

[0037] gp120-R:AGCCAGAGGTCGAGGTCGGGCTCGAGTTAAGTTGGGGCGATGC...

Embodiment 3

[0061] Example 3 Antigen protein expression and purification

[0062] The extracted plasmid was transiently transfected into 293-6E suspension cells, and the cell culture supernatant was harvested 72 hours later. BG505 UFO, CM, PAM and PCM trimeric proteins were obtained by affinity chromatography with lentil lectin and size exclusion chromatography with superdex 200, and then identified by protein electrophoresis. Specific steps are as follows:

[0063] (1) Transient transfection of 293-6E

[0064] 1. After recovery, the cells can be propagated to more than three passages. If the cells are in good condition, they can be transfected.

[0065] 2. Count the cells before transfection to ensure that the cell density is at 1.5xl0 6 cells / mL.

[0066] 3. Prepare the DNA / PEI complex, DNA:PEI=1:3, the final concentration of DNA is 1.25μg / 1×10 6 The cells were added to the new medium, and DNA and PEI (1 μg / μL) were added to 2 mL of the medium, and after incubation for 5 minutes, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biomedicine, relates to an envelope protein trimer immunogen capable of inducing HIV-1 broad spectrum and neutralizing antibody and application thereof, in particular to an envelope protein Env common gene sequence designed based on HIV-1 Chinese epidemic strain and a stable envelope protein gp120 trimer immunogen obtained based on the sequence. The inventionfurther relates to the application of the HIV-1 envelope protein gp120 trimer immunogen in preparation of AIDS vaccines.

Description

technical field [0001] The invention relates to the field of biomedicine, and relates to an envelope protein gp120 trimer immunogen capable of inducing broad-spectrum neutralizing antibodies against global HIV-1 epidemic strains. It specifically relates to the envelope protein Env common gene sequence designed based on HIV-1 epidemic strains in China, and the stable envelope protein gp120 trimer immunogen obtained based on the sequence. The present invention further relates to the use of the HIV-1 envelope protein gp120 trimer immunogen for preparing AIDS vaccine. Background technique [0002] Acquired immunodeficiency syndrome (AIDS), which is a major infectious disease caused by the transmission of human immunodeficiency virus (HIV), ranks among the top 10 global health issues in 2019 announced by the World Health Organization. One of the threats [1]. The AIDS epidemic situation in my country is also grim, and the number of infected people continues to rise. As of the e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C07K14/16A61K39/21A61P31/18
CPCC07K14/005A61K39/12A61P31/18C12N2740/16122C07K2319/00C12N2740/16134
Inventor高峰于湘晖孔维于彬毕金鹏
OwnerJILIN UNIV