Technique for realizing precisely fixed-point RNA shearing in fish embryos
A technology for precise positioning and zebrafish embryos, applied in the biological field, can solve the problems of easy off-target, long order cycle, high toxicity, etc., and achieve the effect of simple components, low cost, and low toxicity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Preparation of wild-type CasRx sequence, exogenous fluorescent protein (EGFP, BFP) mRNA and sgRNA
[0047] The wild-type CasRx sequence was added to the nuclear localization sequence (the sequence is CCGCCACC), and then the SP6 promoter sequence (the sequence is CATACGATTTAGGTGACACTATAGAA) was added upstream of the entire sequence, and the in vitro transcription kit was used to obtain capping (capped) And polyA-tailed mRNA, purified and extracted RNA was frozen at -80 degrees for later use; primers for exogenous fluorescent protein (GFP, BFP) DNA were designed to synthesize DNA, and mRNA was synthesized by in vitro transcription, and the extracted RNA was purified and extracted at -80 degrees Cryopreserved for later use; different sgRNAs were synthesized with a fixed sequence upstream of the T7 promoter and a different downstream sequence partially complementary to the upstream through DNA synthesis, amplified by PCR to obtain double-stranded DNA, obtained usin...
Embodiment 2
[0056] Example 2. In vivo cleavage of exogenous EGFP mRNA sequence in zebrafish embryos
[0057] The wild-type CasRx sequence was added to the nuclear localization sequence (nucleus localization sequence), and then the SP6 promoter sequence was added upstream of the entire sequence, and capped and polyA-tailed mRNA was obtained using an in vitro transcription kit. The DNA sequence was obtained by using an in vitro transcription kit to obtain the exogenous EGFP mRNA sequence. The sgRNA was synthesized through DNA upstream with a T7 promoter sequence and a downstream sequence that was partially complementary to the upstream. After PCR amplification, double-stranded DNA was obtained. Using in vitro transcription reagents box; then stored at -80°C for future use. During the microinjection, single-cell embryos were mixed and injected in a certain ratio, and the fluorescent images were taken with a confocal microscope at 12 hours, and the frozen embryos were to be analyzed by qPCR. ...
Embodiment 3
[0060] Example 3. In vivo cleavage of exogenous BFP mRNA sequences in zebrafish embryos
[0061] The wild-type CasRx sequence was added to the nuclear localization sequence (nucleus localization sequence), and then the SP6 promoter sequence was added upstream of the entire sequence, and capped and polyA-tailed mRNA was obtained using an in vitro transcription kit. The DNA sequence is obtained by using an in vitro transcription kit to obtain the exogenous BFP mRNA sequence. The sgRNA is synthesized by DNA upstream with a T7 promoter sequence and a downstream sequence that is partially complementary to the upstream. After PCR amplification, double-stranded DNA is obtained. Using in vitro transcription reagents box; then stored at -80°C for future use. During the microinjection, single-cell embryos were mixed and injected in a certain ratio, and the fluorescent images were taken with a confocal microscope at 12 hours, and the frozen embryos were to be analyzed by qPCR.
[0062] ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com