Technique for realizing precisely fixed-point RNA shearing in fish embryos

A technology for precise positioning and zebrafish embryos, applied in the biological field, can solve the problems of easy off-target, long order cycle, high toxicity, etc., and achieve the effect of simple components, low cost, and low toxicity

Pending Publication Date: 2020-01-10
FUZHOU UNIV
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the effect of MO technology is good, it is easy to miss the target, so it is generally necessary to design two specific MO sequences when knockdowning each gene. In addition, the company that synthesizes MO is not in China, resulting in a long order cycle.
Moreover, MO technology has defects such as high toxicity in addition to off-target (Stainier et al., 2017; Van Gils and Vanakker, 2019)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Technique for realizing precisely fixed-point RNA shearing in fish embryos
  • Technique for realizing precisely fixed-point RNA shearing in fish embryos
  • Technique for realizing precisely fixed-point RNA shearing in fish embryos

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Preparation of wild-type CasRx sequence, exogenous fluorescent protein (EGFP, BFP) mRNA and sgRNA

[0047] The wild-type CasRx sequence was added to the nuclear localization sequence (the sequence is CCGCCACC), and then the SP6 promoter sequence (the sequence is CATACGATTTAGGTGACACTATAGAA) was added upstream of the entire sequence, and the in vitro transcription kit was used to obtain capping (capped) And polyA-tailed mRNA, purified and extracted RNA was frozen at -80 degrees for later use; primers for exogenous fluorescent protein (GFP, BFP) DNA were designed to synthesize DNA, and mRNA was synthesized by in vitro transcription, and the extracted RNA was purified and extracted at -80 degrees Cryopreserved for later use; different sgRNAs were synthesized with a fixed sequence upstream of the T7 promoter and a different downstream sequence partially complementary to the upstream through DNA synthesis, amplified by PCR to obtain double-stranded DNA, obtained usin...

Embodiment 2

[0056] Example 2. In vivo cleavage of exogenous EGFP mRNA sequence in zebrafish embryos

[0057] The wild-type CasRx sequence was added to the nuclear localization sequence (nucleus localization sequence), and then the SP6 promoter sequence was added upstream of the entire sequence, and capped and polyA-tailed mRNA was obtained using an in vitro transcription kit. The DNA sequence was obtained by using an in vitro transcription kit to obtain the exogenous EGFP mRNA sequence. The sgRNA was synthesized through DNA upstream with a T7 promoter sequence and a downstream sequence that was partially complementary to the upstream. After PCR amplification, double-stranded DNA was obtained. Using in vitro transcription reagents box; then stored at -80°C for future use. During the microinjection, single-cell embryos were mixed and injected in a certain ratio, and the fluorescent images were taken with a confocal microscope at 12 hours, and the frozen embryos were to be analyzed by qPCR. ...

Embodiment 3

[0060] Example 3. In vivo cleavage of exogenous BFP mRNA sequences in zebrafish embryos

[0061] The wild-type CasRx sequence was added to the nuclear localization sequence (nucleus localization sequence), and then the SP6 promoter sequence was added upstream of the entire sequence, and capped and polyA-tailed mRNA was obtained using an in vitro transcription kit. The DNA sequence is obtained by using an in vitro transcription kit to obtain the exogenous BFP mRNA sequence. The sgRNA is synthesized by DNA upstream with a T7 promoter sequence and a downstream sequence that is partially complementary to the upstream. After PCR amplification, double-stranded DNA is obtained. Using in vitro transcription reagents box; then stored at -80°C for future use. During the microinjection, single-cell embryos were mixed and injected in a certain ratio, and the fluorescent images were taken with a confocal microscope at 12 hours, and the frozen embryos were to be analyzed by qPCR.

[0062] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a technique for realizing precisely fixed-point RNA shearing in fish embryos. A CasRx-mediated RNA editing technique is used, only mRNA of CasRx and specific targeted guidance RNA need to be provided, precisely fixed-point RNA knockdown can be realized in the fish embryos, and the technique has the advantages such as high efficiency, high specificity, convenience and low cost. The problems of faced low efficiency of a current existing siRNA technique and high cost and prone off-target of a Morpholino-technique-mediated gene knockout technique are solved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a technology for realizing precise fixed-point RNA shearing in fish embryos. Background technique [0002] With the continuous development and improvement of whole genome sequencing technology and the implementation of large-scale genome annotation projects, biological science research has entered the post-genome era. In the post-genome era, the focus of genome research will shift to gene function, that is, from determining the DNA sequence of genes and explaining all the genetic information of life to the study of biological functions at the molecular level, exploring human health and human health at the molecular level. The mystery of disease (Peltonen and McKusick, 2001). Researchers have begun to make various attempts to apply the results of genome research to various fields of basic scientific research and personalized medicine (Chan and Ginsburg, 2011). However, i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/90C12Q1/6851
CPCC12N15/902C12Q1/6851A01K2217/075A01K2227/40C12Q2531/113C12Q2563/107
Inventor何小镇钟丽丽
OwnerFUZHOU UNIV