Gene combination for producing betaine by expression in rice seed endosperm and application thereof

A technology of rice seeds and betaine, which is applied in the field of genetic engineering, can solve the problems affecting the production of betalain in beet, etc.

Inactive Publication Date: 2020-01-14
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The main source of betalain is sugar beet, but many factors can significantly affect the yield of betalain in beet. At present, betalain from beet can only meet 10% of the global food additive demand (Manchali et al., Stability of betalain pigments of red beet.In Red Beet Biotechnology; Neelwarne, B., Ed.; Springer US: Boston, MA, 55-74.2013), therefore, need to find another way to produce betalain so as to meet the global food additives requirements need

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene combination for producing betaine by expression in rice seed endosperm and application thereof
  • Gene combination for producing betaine by expression in rice seed endosperm and application thereof
  • Gene combination for producing betaine by expression in rice seed endosperm and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] 1. Three-segment gene optimization design and synthesis

[0048] Optimization is carried out according to the following principles: (1) optimize gene codons, improve gene translation efficiency according to rice codon preference; (2) eliminate the recognition sites of commonly used restriction endonucleases inside genes, and facilitate the construction of expression cassettes; (3) ) Eliminate inverted repeat sequence, stem-loop structure and transcription termination signal, balance the GC / AT inside the gene, and improve the stability of RNA; (4) make the gene-encoded protein conform to the N-terminal principle, so as to improve the stability of the translated protein; ( 5) Optimize the free energy of the secondary structure of mRNA to improve the efficiency of gene expression.

[0049] Using the melo gene (GenBank No.D37929.1) of Aspergillus oryzae as a template, according to the rice codon preference, the meloS gene with the DNA sequence shown in SEQ ID NO.1 was optim...

Embodiment 2

[0065] Embodiment 2 identification transgenic rice

[0066] 1. PCR detection of transformed plant genomic DNA

[0067] The genome is extracted from the mature seeds obtained in Example 2, and the genomic DNA is used as a template to detect exogenous genes meloS, BvDODA1S and BvCYP76AD1S using specific primers. The specific sequences of the primers used are as follows:

[0068] meloSZ: Atggcatctgttgaaccaatc;

[0069] meloSF:ttaacgcatagtaccaacagt;

[0070] BvDODA1SZ: atgaagatgattgaatggtgaa;

[0071] BvDODA1SF: ttaagcagaggtgaacttgta;

[0072] BvCYP76AD1SZ: atggatcatgcaactttggca;

[0073] BvCYP76AD1SF: ttagtaacgtgggattggaat.

[0074] Amplification program used: 94°C for 30s, 54°C for 30s, 72°C for 120s, a total of 45 cycles, and finally 72°C for another 10min. For the results, see figure 2 .

[0075] figure 2 The results showed that the wild-type (WT) control could not amplify the exogenous gene, but the vector carrying the three genes was stable, and the exogenous gene ...

Embodiment 3

[0086] Embodiment 3 Appearance observation and betaine content detection of transgenic rice seeds

[0087] The transgenic rice seeds were harvested when they were fully mature and dried in the field. After shelling, the color of the rice seeds was observed with the naked eye. By observing the appearance of the transgenic rice seeds and wild-type seeds, it can be clearly seen that the ratio of the transgenic rice seeds with the three genes Wild-type rice seeds had a darker color ( Figure 6 ).

[0088] Extraction and high-performance liquid chromatography (HPLC) identification of transgenic rice seed betaine: take 0.1g rice seed and grind it into powder on ice, add 2mL methanol and continue to grind uniformly for 5min; ) for 10 minutes; centrifuge at 8000 rpm at 4°C for 5 minutes to collect the supernatant; repeat the extraction of the precipitate until the precipitate is white;

[0089] The supernatant was centrifuged at 8000rpm at 4°C for 5 minutes and combined, and the col...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

The invention relates to a gene combination for producing betaine by expression in rice seed endosperm and an application of thereof, the gene combination comprises a meloS gene, a BvDODA1S gene and aBvCYP76AD1S gene, and further, a nucleotide sequence of the meloS gene is shown as SEQ ID NO.1; the nucleotide sequence of the BvDODA1S gene is as shown in SEQ ID NO.2, and the nucleotide sequence ofthe BvCYP76AD1S gene is as shown in SEQ ID NO. 3, the ORF of the three genes is connected between a rice endosperm specific globulin gene promoter and a terminator to construct a gene box, the gene box is inserted in a plant binary vector, and the betaine-rich rice is obtained, and the obtained rice seeds can be directly used for eating, can also be used as the betaine production raw material seeds, and provide important guiding significance and production application value for the breeding of novel functional crops.

Description

technical field [0001] The invention belongs to the field of genetic engineering, in particular to a gene combination for expressing and producing betaine in rice seed endosperm and its application. Background technique [0002] Betalain is a water-soluble nitrogen-containing pigment widely used in the world. It is composed of red-purple β-anthocyanin and betaflavin, and mainly exists in Caryophyllales and some higher orders. From a chemical point of view, betaine is an ammonium conjugate of betaine aldehyde (BA) with cyclodopa and amino acids or organic amines (betaine, yellow), which are found in our diet. Betalain also has the therapeutic ability to promote health and prevent diseases, such as hypertension, dyslipidemia, cancer, nervous disorders and narrowing of blood vessels. [0003] Given its toxicological safety and possible beneficial biological effects on health, betanin is the only source of betalain additives permitted in food in the United States and the Europe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N15/82A01H5/10A01H6/46A01H4/00
CPCA01H4/00C12N9/0004C12N9/0059C12N9/0081C12N15/8243C12N2800/22C12Y110/03001C12Y114/15006
Inventor付晓燕姚泉洪彭日荷田永生韩红娟许晶李振军高建杰王波王丽娟张福建黄悠楠张文慧
OwnerSHANGHAI ACAD OF AGRI SCI