Fluorescent probe

A technology of fluorescent probes and probes, applied in DNA/RNA fragments, measurement/inspection of microorganisms, recombinant DNA technology, etc., can solve problems such as unsuitable polymerases, achieve great practical value, easy preparation, and wide application range Effect

Pending Publication Date: 2020-01-24
CHENGDU INST OF BIOLOGY CHINESE ACAD OF S
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, TaqMan probes rely on the 5'-3' exonuclease activity of Taq enzymes, so they are not suitable for amplification reactions that use polymerases that do not have 5'-3' exonuclease activity, such as existing large Partial isothermal amplification reaction (SDA, RPA, LAMP, RCA, CPA, HAD, EXPAR, NASBA, MDA)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent probe
  • Fluorescent probe
  • Fluorescent probe

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1. Examples of fluorescent probes applied to quantitative detection of loop-mediated amplification reactions

[0039] The fragment of the BRAF gene was cloned into the plasmid T1, and the recombinant plasmid was sequenced and verified to obtain the recombinant plasmid T1-BRAF as a template for the amplification reaction. Loop-mediated amplification primers and fluorescent probes were designed for the BRAF gene sequence.

[0040] BRAF gene fragment sequence:

[0041] 5'-TAAAAATAGGTGATTTTGGTCTAGCTACAGTGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCTACAGCTTTCAGTCAGATGTATATGC-3'

[0042] (1) Loop-mediated amplification primers and fluorescent probe sequences:

[0043] FIP: 5'-AGACAACTGTTCAAACTGATGGGTAAAAATAGGTGATTTTGGTCTAGC-3'

[0044] BIP: 5'-TCCATTTTGTGGATGGCACCGCATATACATCTGACTGAAAGC-3'

[0045] LB:5'-GCAAGATAAAAATCCATACA-3'

[0046] F3:5'-TATTTCTTCATGAAGACC-3'

[0047] B3:5'-CCAGTCATCAATTCATAC-3'

[0048] PM ...

Embodiment 2

[0058] Embodiment 2, single nucleotide polymorphism detection example

[0059] The recombinant plasmid in Example 1 was mutated to obtain a mutant plasmid corresponding to BRAF (V600E), and T1-BRAF and T1-BRAF-M were used as templates for detection respectively.

[0060] Mutation template sequence:

[0061] TAAAAATAGGTGATTTTGGTCTAGCTACAGAGAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCCATACAGCTTTCAGTCAGATGTATATGC

[0062] The bases in italics indicate the mutation sites.

[0063] The primers and probes designed in Example 1 were used to distinguish between normal plasmids and mutant plasmids.

[0064] (1) Reaction system and reaction conditions

[0065]

[0066]

[0067] Finally, the reaction system was made up to 25 μL with sterilized deionized water.

[0068] The reaction conditions are: react at 60°C for 70 minutes.

[0069] (3) Detection method

[0070] Using a real-time fluorescent PCR instrument, set the FAM chan...

Embodiment 3

[0073] Example 3, Fluorescent Probes Realize Specific Detection Example of Loop-Mediated Amplification Reaction

[0074] In Example 1, the sequence of the recombinant plasmid T1-BRAF and the complementary pairing of the fluorescent probe was replaced with any sequence, and the replaced sequence could not be complementary to the fluorescent probe to obtain a new plasmid T1-BRAF-N, respectively with T1-BRAF and T1-BRAF-N as templates for detection.

[0075] The template sequence after replacement is as follows:

[0076] TAAAAATAGGTGATTTTGGTCTAGCATGTCGCAACAATATTATGACTATACCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGCACCAGAAGTCATCAGAATGCAAGATAAAAATCATACAGCTTTCAGTCAGATGTATATGC

[0077] The parts in italics are the replaced sequences.

[0078] (1) Reaction system and reaction conditions

[0079]

[0080]

[0081] Finally, the reaction system was made up to 25 μL with sterilized deionized water.

[0082] The reaction conditions are: react at 60°C for 90 minutes.

[0083] (3) D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of molecular biology, and provides a specific nucleic acid probe capable of achieving target molecule qualitative and real-time fluorescent quantitative detection. A 5' terminal and a 3' terminal of the probe are marked with a quenching group and a fluorescent group respectively, after the probe and a target sequence are subjected to complementation, atleast one base pair mismatch is formed at the 3' terminal, and under the effect of a 3' terminal mismatch nucleotide cleavage enzyme, the probe is cleaved, and then a fluorescent signal is released.A last base of the 3' terminal of the probe is designed at a single-nucleotide polymorphic site, and thus single-nucleotide polymorphism detection can be achieved. The probe can be further combined with a nucleic acid amplification strategy to detect target nucleic acids more sensitively. The specific nucleic acid probe is simple in design, and can be widely applied to all nucleic acid detection systems into which the 3' terminal mismatch nucleotide cleavage enzyme can be introduced.

Description

technical field [0001] The invention relates to nucleic acid probe technology, in particular to a nucleic acid probe capable of realizing real-time fluorescence quantitative and specific detection of target molecules. Background technique [0002] A nucleic acid probe is a nucleic acid sequence with a known sequence, a detection label, and a complementary nucleic acid sequence to the target gene sequence. Nucleic acid probes are usually labeled with a certain chemical group. When the nucleic acid probe is combined with the target gene through molecular hybridization, a hybridization signal is generated, thereby converting the nucleic acid sequence signal into an optical or electrical signal that is easy to read and analyze. Sequences are detected from a large number of unrelated nucleic acid sequences, and nucleic acid probes have therefore become powerful analytical tools commonly used in the field of genetic testing. The earliest nucleic acid probes used were usually labe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6827C12Q1/6818C12N15/11
CPCC12Q1/6827C12Q1/6818
Inventor唐卓陈刚毅董娟
OwnerCHENGDU INST OF BIOLOGY CHINESE ACAD OF S