Construction method of gtpch enzyme deficiency mouse model with motor dysfunction phenotype

A technology of motor dysfunction and construction method, which is applied in the field of construction of a mouse model of motor dysfunction phenotype GTPCH enzyme deficiency, and can solve problems such as inability to use disease mechanism and treatment research.

Active Publication Date: 2021-07-06
GUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, scientists in Cambridge, UK reported Gch1 knockout mice. However, the mice were embryonic lethal and could not be used for research on the disease mechanism and treatment of DRD caused by GTPCH enzyme deficiency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of gtpch enzyme deficiency mouse model with motor dysfunction phenotype
  • Construction method of gtpch enzyme deficiency mouse model with motor dysfunction phenotype
  • Construction method of gtpch enzyme deficiency mouse model with motor dysfunction phenotype

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] This example provides a method for constructing a mouse model of motor dysfunction phenotype GTPCH enzyme deficiency disease. For the construction steps, see figure 1 , including the following steps:

[0054] 1. Establishment of Gch1p.Leu108Arg point mutation heterozygous mice based on classical B6 strain (C57BL / 6) mice by CRISPR / Cas9 technology

[0055] 1.1 CRISPR / Cas9 Targeting System

[0056] Human GCH1 p.Leu117 is located at the entrance of the binding pocket of the catalytic substrate GTP of the GTPCH enzyme. Mutation to arginine will cause steric hindrance and affect the binding of the substrate GTP to the enzyme. Mouse p.Leu108 is highly conserved with human p.Leu117. Based on this, a synthetic guide sgRNA (SEQ ID No.1) and an oligonucleotide donor (ssDNA) for homologous recombination repair were designed.

[0057] sgRNA (SEQ ID No.1): CATCAAATATAGCATCATTCAGG

[0058] ssDNA (SEQ ID No. 2):

[0059] AAAATATTTACTATCCTTCAGTATTTAACCAATTTTGTGTTTTCCCGGTTCCAGATGTAC...

Embodiment 2

[0108] This example provides a method for constructing a mouse model of motor dysfunction phenotype GTPCH enzyme deficiency disease. The construction steps refer to Example 1, and the changes relative to Example 1 are "2. F1 generation heterozygous mutant mice" In the step, wild-type mice of 129Sv strain were used instead of wild-type mice of DBA / 2 strain. The results are shown in Table 3, Figure 7 , Figure 8 .

[0109] table 3

[0110]

[0111] According to Table 3, it can be seen that, using the construction method of this example, GCH1 homozygous mutant mice almost completely avoid the problem of embryonic lethality. according to Figure 7 It can be seen that, adopting 129Sv strain wild-type mice to cross with Gch1 missense mutant heterozygous mice under the C57BL / 6 strain background and then selfing the F1 generation heterozygotes to obtain homozygous mutant mice can also improve the homozygous mutant mice. (Gch1 KI / KI rats) birth rate and survival time. Althou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing a motor dysfunction phenotype GTPCH enzyme deficiency mouse model. The construction includes: (1) obtaining Gch1 p.Leu108Arg heterozygous mutant mice, the leucine codon at position 108 of the Gch1 gene of the heterozygous mutant mice is mutated into an arginine codon; (2) The heterozygous mutant mice are crossed with wild-type mice of other strains to screen the F1 generation heterozygous mutant mice; (3) the F1 generation heterozygous mutant mice are selfed to screen the F2 generation homozygous mutant mice. This construction method can avoid the lethal problem during the development of GTPCH enzyme-deficient embryos, and the birth rate of homozygous mutant mice can reach or approach Mendel's expected ratio. At the same time, the crossbreeding of mice with different genetic backgrounds can also improve the survival of F2 generation mice after birth and prolong the average survival period.

Description

technical field [0001] The invention relates to the field of animal model construction, in particular to a method for constructing a motor dysfunction phenotype GTPCH enzyme deficiency mouse model. Background technique [0002] Dopa-responsive dystonia (Dopa-Responsive Dystonia, DRD) is a group of monogenic genetic diseases of dopamine synthesis disorder listed in the "First List of Rare Diseases". The main clinical manifestations are abnormal muscle tone, motor dysfunction, language dysfunction, depression, etc. The application of levodopa treatment can partially improve the clinical symptoms and signs, so it is called DRD. Many enzymes and coenzymes are involved in the biosynthesis of dopamine and 5-hydroxytryptamine. Mutations in genes involved in encoding these enzymes and coenzymes may lead to abnormal coding enzymes, leading to DRD. Among them, the GCH1 gene was the first to be discovered and the most reported DRD pathogenic gene. [0003] The GCH1 gene is located on...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/90C12N15/85A01K67/027
CPCA01K67/0276A01K2217/075A01K2227/105A01K2267/0306C12N9/78C12N15/8509C12N15/907C12Y305/04016
Inventor蒋晓玲刘丽郑晓宁刘华圳
OwnerGUANGZHOU WOMEN AND CHILDRENS MEDICAL CENTER