MiR1866 gene for controlling rice seed germination, overexpression vector and preparation method thereof, gRNA expression vector, and application thereof

A technology of mir1866, pre-mir1866-r, applied in the directions of botanical equipment and methods, biochemical equipment and methods, DNA/RNA fragments, etc.

Active Publication Date: 2020-03-24
HENAN AGRICULTURAL UNIVERSITY
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still few studies on miRNA regulation of rice seed germination.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MiR1866 gene for controlling rice seed germination, overexpression vector and preparation method thereof, gRNA expression vector, and application thereof
  • MiR1866 gene for controlling rice seed germination, overexpression vector and preparation method thereof, gRNA expression vector, and application thereof
  • MiR1866 gene for controlling rice seed germination, overexpression vector and preparation method thereof, gRNA expression vector, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] The construction of the expression vector for mutating miR1866 gene comprises the following steps:

[0043] 1. Selection of gRNA target sequence of miR1866 gene and design of upstream and downstream primers of gRNA oligonucleotide chain

[0044] Design gRNA target sequence 5'-GGGATTTTGCGGGAATTTCA according to the sequence of rice miR1866 precursor (miRBase accession number MI0008267) CGG -3' (as shown in SEQ ID NO.22), the PAM sequence at the 3' end of the sequence is CGG, and the Cas9 protein will cut DNA at the 3-4bp upstream of the CGG sequence to form a smooth end. The target site and the PAM sequence are as follows figure 1 as shown, figure 1 It is a schematic diagram of sgRNA and Cas9 protein targeting miR1866 gene.

[0045] The mature body sequence of miR1866-5p is as follows:

[0046] GAGGGATTTTGCGGGAATTTCACG (shown in SEQ ID NO.1).

[0047] Design the upstream and downstream primers of the gRNA oligonucleotide chain according to the sgRNA sequence. The pr...

Embodiment 2

[0057] The application of the expression vector for mutating the miR1866 gene in the preparation of rice miR1866 gene mutants comprises the following steps:

[0058] 1. Agrobacterium-mediated genetic transformation of rice callus and detection of positive transgenic plants

[0059] Using the heat shock method, referring to the method reported by Hood et al. (Hood et al., 1993), the pH-Ubi-CAS9-miR1866 expression vector was introduced into Agrobacterium agrobacterium EHA105, and the rice variety Nipponbare was infected with Agrobacterium containing the CRISPR / Cas9-gRNA plasmid (Oryza sativa ssp. Japonica cv. Nipponbare) calli were transgenic in rice according to the method reported by Nishimura et al. (Nishimura et al., 2006), and regenerated shoots were obtained by screening with hygromycin. The genomic DNA of the transgenic plants was extracted by the SLS method, and positive screening of the transgenic plants was carried out using the vector universal primer U3-F and sgRNA-R...

Embodiment 3

[0070] The amplification of the miR1866 gene fragment comprises the following steps:

[0071]According to the sequence of the miR1866 gene (as shown in SEQ ID NO.3), the amplification primers Pre-miR1866-F and Pre-miR1866-R containing the miR1866 precursor sequence were designed (see Table 1 for the primer sequence), and according to the restriction site of the target vector pTCK303 point, add KpnI and BamHI restriction sites and protective bases at the 5′ ends of the forward and reverse primers, respectively. Using Nipponbare seedling DNA as a template, the miR1866 gene fragment was amplified, as follows:

[0072] aagc ggtaccGTACCAGGCCTC CTTTTGCACGGAGGGATTTTGCGGGAATTTCACGGGAATTGAGTTG ATTCCTGAAATTCCTGTAAAATTCTTGTGTTCCAAAGGA GCCCTggatcc actagtaata , where the lowercase underlined bases are the protective bases, the lowercase ununderlined bases are the restriction sites KpnI and BamHI, the uppercase underlined bases are the miR1866 precursor sequence, and the uppercase u...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention, which belongs to the technical field of plant genetic engineering, discloses a miR1866 gene for controlling rice seed germination, an overexpression vector and a preparation method thereof, a gRNA expression vector, and application thereof. According to the technical principle of CRISPR / Cas9 and high-expression miRNA, the expression of the miR1866 gene in rice is regulated and controlled. A small interference fragment of the miR1866 gene is designed, expression vectors of pH-Ubi-CAS9-miR1866 and pTCK303-miR1866 are constructed, a japonica rice variety Nipponbare is introduced byusing an agrobacterium-mediated method, screening is carried out by using hygromycin (Hyg) resistance marker to obtain a positive transgenic plant, and the mutation of the miR1866 and the expressionquantity of the miR1866 gene are identified respectively by sequencing and a qRT-PCR method. The result shows that a miR1866 mutant plant and a miR1866 high-expression plant are obtained respectively.Compared with the wild Nipponbare, the planted Nipponbare has the following beneficial effects: the seed germination rate of the miR1866 mutant plant is remarkably reduced and the seed germination rate of the miR1866 high-expression plant is remarkably increased.

Description

technical field [0001] The invention relates to a miR1866 gene controlling the germination rate of rice seeds, an overexpression vector comprising the gene, a gRNA expression vector, a preparation method and an application thereof, belonging to the technical field of plant genetic engineering. Background technique [0002] The seed germination process is the initial development process of the plant life cycle. This process determines the state of the plant entering the natural or agricultural ecosystem. The seed germination process is also the process of breaking the dormancy of the seed. Seed dormancy refers to the phenomenon that healthy seeds do not germinate under suitable conditions, which is formed during the evolution of plants and exists widely. In production, the influence of dormancy characteristics of rice is mainly manifested in panicle germination and irregular germination. High temperature and high humidity during the rice maturity stage will cause the seeds o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/66A01H5/10A01H6/46
CPCC12N15/113C12N15/8267C12N15/66
Inventor彭廷赵全志金玉蔓赵亚帆张辉杜彦修李俊周孙红正张静孙虎威杜长青
OwnerHENAN AGRICULTURAL UNIVERSITY