Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of Bifidobacterium lactis bl-99 capable of preventing osteoporosis and its application

A technology of bifidobacterium lactis and osteoporosis, applied in the field of microorganisms, to achieve the effect of wide application prospects

Active Publication Date: 2021-05-28
INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after investigation, there are few technical reports on the use of Bifidobacterium lactis for the treatment and / or prevention of osteoporosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Bifidobacterium lactis bl-99 capable of preventing osteoporosis and its application
  • A kind of Bifidobacterium lactis bl-99 capable of preventing osteoporosis and its application
  • A kind of Bifidobacterium lactis bl-99 capable of preventing osteoporosis and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Bifidobacterium lactis BL-99 and its performance measurement

[0043] The Bifidobacterium lactis BL-99 of the present invention comes from Shanghai Jiaotong University Onli Co., Ltd. and is isolated from the intestinal tract of infants. This strain has been deposited in the China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), classification name: Rubifidum Bifidobacterium lactis; Accession No. CGMCC No.15650.

[0044] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99

[0045] Physical and chemical test results:

[0046]

[0047] 16S rRNA gene sequence sequencing results (SEQ ID No.1):

[0048] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGCGATCCG...

Embodiment 2

[0062] Example 2: Ovariectomized rat animal model and probiotic intervention

[0063] Bifidobacterium lactis BL-99 strain was cultured in MRS liquid medium at 37°C for 16 hours, centrifuged at 4°C and 2500 rpm for 10 min, the cells were collected, washed with phosphate buffered saline (PBS), freeze-dried at -18°C Save below. For the experimental study of Example 2-Example 5 of the present invention.

[0064] 85 17-week-old female adult SD rats, weighing 200-300 g. Rats were randomly divided into 3 groups with 10 rats in each group. Twenty rats underwent ovariectomy, and the remaining 10 rats underwent sham surgery. Rats were exposed to light / dark for 12 hours a day, room temperature was around 25°C, and water was freely available. After 12 weeks of surgical intervention, the animals in the model observation group were sacrificed, uterus, femur, tibia and other samples were collected, and osteoporosis-related indicators such as uterine coefficient, bone microstructure morph...

Embodiment 3

[0070] Example 3: Bone Histomorphometric Determination

[0071] Take the proximal 1 / 3 of the left tibia, cut it longitudinally along the sagittal plane, and take about 1 × 0.5 × 0.5 cm 3 , soaked in decalcification solution 10% EDTA / PBS (pH 7.4) to complete decalcification, about 1 week, the solution was changed every 3 days, then routinely dehydrated, embedded in paraffin, along the sagittal plane (thickness 4 μm) , HE staining, the total tissue area, trabecular bone area, and total perimeter of trabecular bone can be measured by pathological image analyzer, and then the percentage of trabecular bone area, number of trabecular bone, trabecular bone thickness and bone trabecular bone area can be calculated by calculation formula Trabecular separation. Bone tissue sections were also used to observe the appearance, arrangement, and morphological and structural integrity of trabecular bone.

[0072] After 12 weeks of probiotic BL-99 intervention, HE staining results ( Figure ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides Bifidobacterium lactis capable of preventing osteoporosis and application thereof, belonging to the technical field of microorganisms. The Bifidobacterium lactis provided by the invention has the properties of resistance to gastric acid and intestinal juice, the survival rate of viable bacteria is more than 62% when treated in gastric acid of pH 2.5 for 30 minutes, and the survival rate of viable bacteria is more than 61% after treatment for 2 hours; The survival rate of viable bacteria in the small intestinal fluid for 2 hours was more than 70%. The bacteria can significantly reduce the loss of bone mass caused by estrogen deficiency; increase blood calcium and blood phosphorus; inhibit the number of osteoclasts in the body and inhibit their effect on bone resorption; and can promote the expression of bone anabolism-related factor genes by promoting protein, increasing the level of protein to promote the formation of new bone. The strain of the present invention can be used for preparing food and the like, and has wide application prospects.

Description

technical field [0001] The present invention relates to the technical field of microorganisms, in particular to a strain of Bifidobacterium lactis which has the functions of preventing osteoporosis, increasing calcium ions and / or phosphorus ions in blood and the like. Background technique [0002] Osteoporosis is a systemic metabolic skeletal disease characterized by decreased bone mass and destruction of the microstructure of bone. Its performance is increased bone fragility, which is easy to induce fractures. About 200 million people worldwide currently suffer from osteoporosis. The incidence of hip fractures due to osteoporosis is increasing worldwide, and the elderly population is largely affected by fracture risk. Worldwide, the total number of disabilities is 5.8 million annually. Fifty-one percent of this number were due to fractures, mostly in Europe and the Americas. Therefore, osteoporotic fractures are considered to be an important cause of mortality and morbi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20A61K35/745A61P19/10A23L33/135A23L2/39A23K10/18A23C9/13A23C9/152A23C9/16A23C19/06C12R1/01
CPCC12N1/20A61P19/10A23L33/135A23L2/39A23K10/18A23C9/13A23C9/152A23C9/16A23C19/061A61K2035/115A23V2002/00C12R2001/01C12N1/205A23V2400/531A23V2200/306Y02A50/30
Inventor 冯昊天菲利普·韦斯科姆刘伟贤洪维鍊司徒文佑李昊虬
Owner INNER MONGOLIA YILI INDUSTRIAL GROUP CO LTD