A kind of Bifidobacterium lactis bl-99 capable of preventing osteoporosis and its application
A technology of bifidobacterium lactis and osteoporosis, applied in the field of microorganisms, to achieve the effect of wide application prospects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Bifidobacterium lactis BL-99 and its performance measurement
[0043] The Bifidobacterium lactis BL-99 of the present invention comes from Shanghai Jiaotong University Onli Co., Ltd. and is isolated from the intestinal tract of infants. This strain has been deposited in the China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), classification name: Rubifidum Bifidobacterium lactis; Accession No. CGMCC No.15650.
[0044] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99
[0045] Physical and chemical test results:
[0046]
[0047] 16S rRNA gene sequence sequencing results (SEQ ID No.1):
[0048] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGCGATCCG...
Embodiment 2
[0062] Example 2: Ovariectomized rat animal model and probiotic intervention
[0063] Bifidobacterium lactis BL-99 strain was cultured in MRS liquid medium at 37°C for 16 hours, centrifuged at 4°C and 2500 rpm for 10 min, the cells were collected, washed with phosphate buffered saline (PBS), freeze-dried at -18°C Save below. For the experimental study of Example 2-Example 5 of the present invention.
[0064] 85 17-week-old female adult SD rats, weighing 200-300 g. Rats were randomly divided into 3 groups with 10 rats in each group. Twenty rats underwent ovariectomy, and the remaining 10 rats underwent sham surgery. Rats were exposed to light / dark for 12 hours a day, room temperature was around 25°C, and water was freely available. After 12 weeks of surgical intervention, the animals in the model observation group were sacrificed, uterus, femur, tibia and other samples were collected, and osteoporosis-related indicators such as uterine coefficient, bone microstructure morph...
Embodiment 3
[0070] Example 3: Bone Histomorphometric Determination
[0071] Take the proximal 1 / 3 of the left tibia, cut it longitudinally along the sagittal plane, and take about 1 × 0.5 × 0.5 cm 3 , soaked in decalcification solution 10% EDTA / PBS (pH 7.4) to complete decalcification, about 1 week, the solution was changed every 3 days, then routinely dehydrated, embedded in paraffin, along the sagittal plane (thickness 4 μm) , HE staining, the total tissue area, trabecular bone area, and total perimeter of trabecular bone can be measured by pathological image analyzer, and then the percentage of trabecular bone area, number of trabecular bone, trabecular bone thickness and bone trabecular bone area can be calculated by calculation formula Trabecular separation. Bone tissue sections were also used to observe the appearance, arrangement, and morphological and structural integrity of trabecular bone.
[0072] After 12 weeks of probiotic BL-99 intervention, HE staining results ( Figure ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


