Detection kit and detection method for human BRAF gene V600E mutation
A detection kit and detection method technology, applied in the field of molecular biology, can solve problems such as difficult detection of ctDNA, and achieve the effects of saving experimental consumption and labor costs, saving detection costs, and simple and accurate interpretation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] 1. Preparation of primers, probes and inhibitors included in the kit for detecting BRAF gene V600E mutation in human blood samples
[0053] According to the wild-type sequence of the BRAF gene (Gene ID: 673) published in the NCBI database, and taking the V600E mutation site (rs113488022) of the BRAF gene as a reference, specific arms-PCR primers and probes were designed. Using the mutant plasmid and wild-type plasmid constructed by genetic engineering as templates, a real-time fluorescent PCR detection system was established to achieve high sensitivity and high specificity detection of BRAF gene V600E mutation.
[0054] The primers and probes for detecting BRAF gene V600E mutation are characterized in that the detection primers and probes are designed according to the BRAF gene V600E mutation site, and the sequence is as follows:
[0055] Upstream primer: GTAAAAATAGGTGCTTTTGGTATAGCTGCCGA
[0056] Downstream primer: CTTTCTAGTAACTCAGCAGCATCTCAGG
[0057] Fluorescent pro...
Embodiment 2
[0110] The usage of the kit of the present invention will be described in detail below in conjunction with specific example 2. This example is implemented under the technical premise of the present invention, and the detailed implementation and specific operation process are given. In Example 2, the peripheral blood samples and puncture tissue samples of 10 patients with thyroid cancer were collected at the same time, and they were respectively named as No. 1-10 samples. The ctDNA in No. 1-10 peripheral blood was detected by the method of the present invention. The detection results of ctDNA in No. 1 peripheral blood were compared with the results of the first-generation sequencing of BRAF gene in No. 1-10 punctured tissue DNA to confirm the accuracy of the present invention.
[0111] 1. Detection method:
[0112](1) ctDNA extraction of clinical patient samples: ctDNA was extracted from the peripheral blood samples of thyroid cancer patients No. In the present invention, HiPu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



