Method for high-yield production of L-cysteine by metabolic engineering modification of corynebacterium glutamicum

A technology of Corynebacterium glutamicum and cysteine, which is applied in the fields of synthetic biology and metabolic engineering, and can solve the problems of difficulty in meeting industrial production needs and low yield.

Active Publication Date: 2020-04-21
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the low output, it is difficult to meet the needs of industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for high-yield production of L-cysteine by metabolic engineering modification of corynebacterium glutamicum
  • Method for high-yield production of L-cysteine by metabolic engineering modification of corynebacterium glutamicum
  • Method for high-yield production of L-cysteine by metabolic engineering modification of corynebacterium glutamicum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Example 1 Construction of Corynebacterium glutamicum L-cysteine ​​desulfhydrylase gene aecD deletion strain

[0019] (1) Extraction of C. glutamicum ATCC13032 genome template

[0020] C. glutamicum ATCC13032 was cultured in LB medium (20-25g / L peptone, 10-20g / L yeast powder, 20-25g / L sodium chloride) at 30°C and 150-200rpm for 12-16h, then used genome extraction reagent Kit (Tiangen) to extract total DNA.

[0021] (2) Design primers aecD1-F / aecD1-R, aecD2-F / aecD2-R using the C. glutamicum ATCC13032 genome as a template, and their sequences are:

[0022] aecD 1-F: cgcggatcccgacagtcaatgcgatgcc;

[0023] aecD 1-R:acgaagaattttagaaggcctttccgcaacccacaaagg;

[0024] aecD 2-F: tgtgggttgcggaaaggccttctaaaattcttcgtgagg;

[0025] aecD 2-R: tgctctagaaacggccaacaccgtatcc.

[0026] Using the primers designed above, fragments aecD1 and aecD2 were obtained by PCR. Then obtain the PCR products aecD1 and aecD2 as templates, use aecD1-F / aecD2-R as primers, obtain the fusion fragment a...

Embodiment 2

[0036] Example 2 Construction of overexpressed self-serine transacetylase gene cysE strain

[0037] (1) Design primers CgcysE-F / CgcysE-R using the C. glutamicum ATCC13032 genome as a template, and its sequence is:

[0038] CgcysE-F: tccgagctcaaaggaggacaaccatgatccgtgaagatctcgca;

[0039] Cgcys E-R: cggggtaccatagggcgctaactgttcttaaatg.

[0040] Using the above primers, the fragment CgcysE was obtained by PCR. Then, after double digestion with SacI and KpnI, it was connected to the vector pTrcmob to obtain the plasmid pTrc-1.

[0041] PCR system: ddH 2 O 30 μL, template 1 μL, Fastpfu buffer 10 μL, Fastpfu 1 μL, primer 1 1.5 μL, primer 21.5 μL, dNTP 5 μL.

[0042] PCR conditions: Step 1 at 94°C for 4min, Step 2 at 94°C for 30s, Step 3 at 60°C for 30s, Step 4 at 72°C for 1min, Step 5 at 72°C for 10min, and Step 6 at 4°C.

[0043] Double digestion system: gene aecD or plasmid pCRD206 20 μL, BamHI 1 μL, XbaI 1 μL, 10×buffer 5 μL, ddH 2 O 23μL, react at 37℃ for 1h.

[0044] Liga...

Embodiment 3

[0047] Example 3 Exploring the influence of serine transacetylase gene cysE from different sources on L-cysteine

[0048] (1) Extract the E.coli MG1655 genome template

[0049] E.coli MG1655 was cultured in LB medium (20-25g / L peptone, 10-20g / L yeast powder, 20-25g / L sodium chloride) at 37°C and 150-200rpm for 12-16h, then the genome extraction reagent was used Kit (Tiangen) to extract total DNA.

[0050] (2) Design primers EccysE-F / EccysE-R using the E.coli MG1655 genome as a template, the sequence of which is:

[0051] EccysE-F: tccgagctcaaaggaggacaacccaatgtcgtgtgaagaactgga;

[0052] Eccys E-R: cggggtaccatgattacatcgcatccgg.

[0053] Using the primers designed above, the fragment CgcysE was obtained by PCR. Then, after double digestion with SacI and KpnI, it was connected to the vector pTrcmob to obtain the plasmid pTrc-2.

[0054] (3) Based on the codon usage preference of Corynebacterium glutamicum, the codon-optimized Arabidopsis cysE gene, whose sequence is shown in ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for high-yield production of L-cysteine by metabolic engineering modification of corynebacterium glutamicum. The method comprises the following steps: knocking out an L-cysteine desulfhydrase gene aecD while overexpressing a serine acetyltransferase gene cysE to obtain an L-cysteine accumulation strain; respectively overexpressing the serine acetyltransferase genescysE of escherichia coli and arabidopsis thaliana, and obtaining EcysE(M201R) most beneficial to L-cysteine synthesis after activity comparison; respectively overexpressing L-cysteine transporter proteins from escherichia coli and pantoea ananatis, and comparing the influences of different transporter proteins on the yield of L-cysteine to obtain a transporter protein Bcr most beneficial to L-cysteine secretion; promoting the synthesis of L-cysteine by improving the level of a precursor L-serine; and finally fermenting for 3-4 days by using 50-60 g / L glucose as a substrate, wherein the contentof L-cysteine reaches 800-1000 mg / L.

Description

technical field [0001] The invention belongs to the technical field of synthetic biology and metabolic engineering, and specifically relates to a method for high-yielding L-cysteine ​​by selecting a food-safe microorganism Corynebacterium glutamicum as a host through a metabolic engineering strategy. Background technique [0002] L-cysteine ​​is an important sulfur-containing amino acid, widely used in feed, food, medicine and cosmetics and other fields. The annual demand for L-cysteine ​​in the global market reaches 5,000 tons, and it shows an increasing trend year by year. Currently, L-cysteine ​​is mainly produced by proteolysis. However, due to the problems of environmental pollution and low yield in the proteolysis production process, the scale and further application of the industrial production of L-cysteine ​​are limited. Therefore, research on the synthesis of L-cysteine ​​by environmentally friendly microbial fermentation has attracted more and more attention (No...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12P13/12C12R1/15
CPCC12P13/12C12N9/13C12N9/1025C07K14/245C07K14/195C12Y208/01007
Inventor刘君魏亮徐宁
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI