Unlock instant, AI-driven research and patent intelligence for your innovation.

AAV double-vector gene treatment system and application thereof to treatment of type II MPS

A gene therapy and vector technology, applied in the field of medical technology treatment, can solve problems such as poor treatment effect, and achieve the effects of enhancing safety, shortening time consumption, and improving the expression of IDS

Pending Publication Date: 2020-05-08
HARBIN MEDICAL UNIVERSITY
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problem that the current treatment effect of mucopolysaccharidosis type II is not good enough, the object of the present invention is to provide an adeno-associated virus (AAV) dual vector gene therapy system using CRISPR-Cas9 as a gene editing tool, and the vector system For application in the treatment of mucopolysaccharidosis type II, the adeno-associated virus (AAV) dual vector gene therapy system of the present invention can fundamentally improve the activity of iduronate-2-sulfatase, thereby effectively Improve clinical symptoms of MPSII genetic disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • AAV double-vector gene treatment system and application thereof to treatment of type II MPS
  • AAV double-vector gene treatment system and application thereof to treatment of type II MPS
  • AAV double-vector gene treatment system and application thereof to treatment of type II MPS

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Embodiment 1 Construction of adeno-associated virus dual vector gene therapy system

[0034] An adeno-associated virus dual-vector gene therapy system for mucopolysaccharidosis type II gene therapy consists of a first vector and a second vector, wherein the first vector is designed to carry the targeted mouse albumin gene (Albumin , Alb) cleavage site-specific small guide RNA (small guide RNA, sgRNA) and the open reading frame (ORF) of the human iduronate-2-sulfatase (human iduronate-2-sulfatase, hIDS) gene ) sequence (NM_000202.8), the mouse albumin gene was analyzed and evaluated through the sgRNA design website (URL: https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna- design) to design sgRNA against mouse albumin gene (sequence: 5'ACTAGCCCTCTGGCAAAATGAA3'). The AAV-DJ vector targets the liver cells of mice with mucopolysaccharidosis Ⅱ disease, and the sgRNA recognizes a specific part of the albumin gene (Alb) in the mouse liver cells (the cleavage si...

Embodiment 2

[0037] Example 2 Gene therapy experiment of adeno-associated virus dual vector gene therapy system on MPSII disease mouse model

[0038] MPSII disease mouse model (B6N.Cg-Ids tm1Muen / J, item number: 024744) were purchased from The Jackson Laboratory (USA), and a total of 2 male breeding mice (Ids X+ / Y ) and 3 Ids gene heterozygous female breed mice (Ids X+ / X- ). Routine breeding and multiplication in the SPF level animal experiment center, giving birth to male MPSII disease mice (Ids X- / Y ). Gene therapy was performed when diseased mice were 6 weeks old. We choose the adeno-associated virus dual vector system (constructed in Example 1), AAV-DJ.SaCas9: 2 × 10 11 GC and AAV-DJ.sgRNA.hIDS: 2×10 12 GC is the dosage of AAV for gene therapy of MPSII disease mouse model. We injected this amount of viral vector through the tail vein to target it to the liver of MPSII mice.

[0039] 1. Analysis of IDS enzyme activity in mouse model of MPSII disease after gene therapy

[0040]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an AAV (Adeno-Associated Virus) double-vector gene treatment system and application thereof to treatment of type II MPS (Mucopolysaccharidosis). The AAV binary vector gene treatment system consists of a first vector and a second vector, wherein the first vector is an AAV vector carrying specific sgRNA (Small Guide RNA) targeting a human Alb (Albumin) gene cleavage site andan ORF (Open Reading Frame) sequence of a human IDS (Iduronate-2-Sulfatase); the cleavage site is located between a second site basic group and a third site basic group of an Alb gene translation initiation codon atg; and the second vector is an AAV vector carrying Cas9. The AAV double-vector gene treatment system using CRISPR-Cas9 as a gene editing tool has the advantages that the plasma IDS enzyme activity and the liver tissue IDS expression of MPSII model mice can be obviously improved; and after the treatment, the mouse phenotype and bone development are improved. The invention provides aneffective treatment measure for clinic treatment of the type II MPS.

Description

technical field [0001] The present invention relates to a gene therapy system for mucopolysaccharidosis type II, a rare genetic disease, in particular to an adeno-associated virus dual vector system for gene therapy of mucopolysaccharidosis type II, and also relates to a construction method of the system and apply. The invention belongs to the field of medical technology treatment. Background technique [0002] Mucopolysaccharidosis (MPS) is a very important type of lysosomal storage disease. Due to the deficiency of lysosomal hydrolase, the degradation of acidic mucopolysaccharides is blocked, and mucopolysaccharides accumulate in the body, causing a series of clinical symptoms. Symptoms, the incidence rate is about 1 / 25 000. MPS can be divided into Ⅰ, Ⅱ, Ⅲ, Ⅳ, Ⅵ, Ⅶ and Ⅸ types, except for MPSI type II, the rest are autosomal recessive genetic diseases. [0003] Mucopolysaccharidosis type II (MPSII) is an X-linked recessive monogenic hereditary disease, the causative gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61P43/00C12N15/864
CPCA61K48/005A61P43/00C12N15/86C12N2750/14143
Inventor 孙文靖吴杰贾学渊于函菲白静傅松滨
Owner HARBIN MEDICAL UNIVERSITY