Unlock instant, AI-driven research and patent intelligence for your innovation.

Fluorescent quantitative PCR detection probe for poultry manure pollution and detection method

A fluorescent quantitative and detection probe technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of different attenuation rates of indicators, differences in the adaptability of microbial traceability technology, and microbial traceability Problems such as indicator phenotype or genotype variation, to achieve high sensitivity and good specificity

Active Publication Date: 2020-05-08
UNIVERSITY OF CHINESE ACADEMY OF SCIENCES
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are regional differences in the application of this technology at present, which are mainly caused by two reasons: (1) In terms of hosts, due to the differences in the ways of raising livestock and poultry in different regions, microorganisms adapt to the intestinal environment of hosts in different regions. In the process of genetic diversity, genetic diversity may be generated, which may cause the phenotype or genotype of microbial traceability indicators to vary; Complexity makes the adaptability of microbial traceability technology vary in different regions
Currently, most poultry fecal contamination markers are invented abroad, so these markers are not suitable for use in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR detection probe for poultry manure pollution and detection method
  • Fluorescent quantitative PCR detection probe for poultry manure pollution and detection method
  • Fluorescent quantitative PCR detection probe for poultry manure pollution and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of AV4143P1 probe

[0023] (1) Sample collection

[0024] In order to make the samples representative, a total of 162 samples were collected from 5 regions in Inner Mongolia, Beijing, Henan, Jiangxi and Guangdong, including 119 samples from poultry sources and 43 samples from non-poultry sources. ① 119 samples from sources of poultry contamination, including 14 poultry bedding samples, 75 chicken manure samples, 10 duck manure samples, 14 goose manure samples and 6 pigeon manure samples. ②43 non-poultry source samples, including 10 pig feces samples, 6 dog feces samples, 6 horse feces samples, 5 donkey feces samples, 6 cow feces samples, 5 goat feces samples and 5 sheep feces samples. After the samples were collected, the samples were transported back to the laboratory as soon as possible using dry ice and stored in a -80°C refrigerator.

[0025] (2) Extraction of DNA

[0026] ①Take 180-220 mg of sample, and use the QIAamp DNA Stool Mini Kit (Q...

Embodiment 2

[0038] The determination of embodiment 2 detection limit

[0039] The detection limit is the lowest copy number detected in the target host sample. Six 10-fold serially diluted plasmid DNA samples (7.45×10 8 -7.45×10 3 Copies) is the standard product, determine the standard curve, and obtain the slope (slope), y-axis intercept and R of the standard curve2 .

[0040] The formula for calculating the reaction efficiency is: E=10 (1 / -slope) -1

[0041] The limit of detection was determined with plasmid DNA samples with copy numbers of 600, 400, 300, 200, 100, 60, 50, 40, 35, 30, 25, 20, 15, 10, 5,0.

[0042] The reaction system included 10 μL 2X TaqMan Environmental Master Mix 2.0 (Applied Biosystems, Foster City, CA, USA), the upstream primer AV4143F with a final concentration of 500 nM, the downstream primer AV4143R with a final concentration of 500 nM, the AV4143P1 probe with a final concentration of 250 nM, and 2 μL of DNA template, add sterile water to 20μL.

[0043] Re...

Embodiment 3

[0048] Embodiment 3 sensitivity and specificity experiment

[0049] (1) Sample collection: Same as Example 1.

[0050] (2) Extraction of DNA: Same as Example 1.

[0051] (3) Detection:

[0052] The experimental group adopts the AV4143P1 probe of the present invention;

[0053] The control group used the AV4143P probe, the nucleotide sequence of which was AGGTGGTTTTGCTATCGCTTT; SEQ ID NO.6.

[0054] The reaction system included 10 μL 2X TaqMan Environmental Master Mix 2.0 (Applied Biosystems, Foster City, CA, USA), the upstream primer AV4143F with a final concentration of 500 nM, the downstream primer AV4143R with a final concentration of 500 nM, the AV4143P1 probe with a final concentration of 250 nM, and 2 μL of DNA template, add sterile water to 20μL.

[0055] Reactions were run on an ABI 7500 real-time qPCR (Applied Biosystems, Foster City, CA, USA) instrument. The reaction procedure was carried out in two steps. The conditions were pre-denaturation at 50°C for 2 min; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent quantitative PCR detection probe for poultry manure pollution and a detection method and belongs to the technical field of biological detection. The invention provides the fluorescent quantitative PCR detection probe for poultry manure pollution. The probe has a nucleotide sequence of 5'-AGATGGTTCTGCTATCGCTTT-3' shown in SEQ ID No. 1. Compared with the prior art, the probe and the method have the beneficial effects that the current situation that poultry manure pollutant markers designed abroad cannot be used in our country is solved, and the fluorescent quantitative PCR detection probe for poultry manure pollution, provided by the invention, is suitable for being used in China and is high in sensitivity and good in specificity. According to the probedesigned by the invention, the sensitivity reaches 86.55%, and the specificity reaches 93.48%.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a poultry feces pollution fluorescent quantitative PCR detection probe and a detection method. Background technique [0002] With the prosperity and development of the poultry farming industry, the production of poultry manure is increasing day by day. Part of the feces will flow into the surface water due to rainwater washing or poor human management, causing certain pollution to the water environment. Feces contain a large number of pathogenic microorganisms harmful to the human body, which can cause diseases such as diarrhea and acute gastroenteritis. Many fecal pathogens can grow and reproduce in large quantities in in vitro environmental water bodies, leading to waterborne transmission of pathogenic microorganisms. How to quickly identify whether there is poultry feces pollution in water bodies has important guiding significance for water body management and p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6851C12Q1/6888C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2531/113C12Q2561/101
Inventor 余志晟梁红霞张洪勋刘如铟
Owner UNIVERSITY OF CHINESE ACADEMY OF SCIENCES