Fluorescent quantitative PCR detection probe for poultry manure pollution and detection method
A fluorescent quantitative and detection probe technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems of different attenuation rates of indicators, differences in the adaptability of microbial traceability technology, and microbial traceability Problems such as indicator phenotype or genotype variation, to achieve high sensitivity and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Construction of AV4143P1 probe
[0023] (1) Sample collection
[0024] In order to make the samples representative, a total of 162 samples were collected from 5 regions in Inner Mongolia, Beijing, Henan, Jiangxi and Guangdong, including 119 samples from poultry sources and 43 samples from non-poultry sources. ① 119 samples from sources of poultry contamination, including 14 poultry bedding samples, 75 chicken manure samples, 10 duck manure samples, 14 goose manure samples and 6 pigeon manure samples. ②43 non-poultry source samples, including 10 pig feces samples, 6 dog feces samples, 6 horse feces samples, 5 donkey feces samples, 6 cow feces samples, 5 goat feces samples and 5 sheep feces samples. After the samples were collected, the samples were transported back to the laboratory as soon as possible using dry ice and stored in a -80°C refrigerator.
[0025] (2) Extraction of DNA
[0026] ①Take 180-220 mg of sample, and use the QIAamp DNA Stool Mini Kit (Q...
Embodiment 2
[0038] The determination of embodiment 2 detection limit
[0039] The detection limit is the lowest copy number detected in the target host sample. Six 10-fold serially diluted plasmid DNA samples (7.45×10 8 -7.45×10 3 Copies) is the standard product, determine the standard curve, and obtain the slope (slope), y-axis intercept and R of the standard curve2 .
[0040] The formula for calculating the reaction efficiency is: E=10 (1 / -slope) -1
[0041] The limit of detection was determined with plasmid DNA samples with copy numbers of 600, 400, 300, 200, 100, 60, 50, 40, 35, 30, 25, 20, 15, 10, 5,0.
[0042] The reaction system included 10 μL 2X TaqMan Environmental Master Mix 2.0 (Applied Biosystems, Foster City, CA, USA), the upstream primer AV4143F with a final concentration of 500 nM, the downstream primer AV4143R with a final concentration of 500 nM, the AV4143P1 probe with a final concentration of 250 nM, and 2 μL of DNA template, add sterile water to 20μL.
[0043] Re...
Embodiment 3
[0048] Embodiment 3 sensitivity and specificity experiment
[0049] (1) Sample collection: Same as Example 1.
[0050] (2) Extraction of DNA: Same as Example 1.
[0051] (3) Detection:
[0052] The experimental group adopts the AV4143P1 probe of the present invention;
[0053] The control group used the AV4143P probe, the nucleotide sequence of which was AGGTGGTTTTGCTATCGCTTT; SEQ ID NO.6.
[0054] The reaction system included 10 μL 2X TaqMan Environmental Master Mix 2.0 (Applied Biosystems, Foster City, CA, USA), the upstream primer AV4143F with a final concentration of 500 nM, the downstream primer AV4143R with a final concentration of 500 nM, the AV4143P1 probe with a final concentration of 250 nM, and 2 μL of DNA template, add sterile water to 20μL.
[0055] Reactions were run on an ABI 7500 real-time qPCR (Applied Biosystems, Foster City, CA, USA) instrument. The reaction procedure was carried out in two steps. The conditions were pre-denaturation at 50°C for 2 min; ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


