A kind of poultry manure pollution fluorescent quantitative PCR detection probe and detection method
A technology for fluorescence quantification and detection of probes, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc. It can solve the problems of different attenuation rates of indicators, differences in the adaptability of microbial traceability technology, markers, etc. Not suitable for use and other problems, to achieve the effect of good specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Construction of AV4143P1 probe
[0023] (1) Sample collection
[0024] To make the samples representative, a total of 162 samples were collected from 5 regions in Inner Mongolia, Beijing, Henan, Jiangxi and Guangdong, including 119 samples from poultry pollution sources and 43 samples from non-avian pollution sources. ①119 poultry pollution source samples, including 14 poultry litter samples, 75 chicken manure samples, 10 duck manure samples, 14 goose manure samples and 6 pigeon manure samples. ②43 samples from non-avian sources, including 10 pig feces, 6 dog feces, 6 horse feces, 5 donkey feces, 6 cattle feces, 5 goat feces and 5 sheep feces. After sample collection is complete, use dry ice to transport the samples back to the laboratory as soon as possible and store them in a -80°C freezer.
[0025] (2) DNA extraction
[0026] ① Take 180-220 mg of sample, and use QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany) DNA extraction kit to extract sample DNA ...
Embodiment 2
[0038] Example 2 Determination of detection limit
[0039] The detection limit is the lowest copy number detected in the target host sample. Plasmid DNA samples (7.45 × 10) were diluted in six 10-fold serial 8 -7.45×10 3 Copies) as the standard, determine the standard curve, and obtain the slope, y-axis intercept and R of the standard curve2 .
[0040] The formula for calculating the reaction efficiency is: E=10 (1 / -slope) -1
[0041] Plasmid DNA samples with copy numbers of 600, 400, 300, 200, 100, 60, 50, 40, 35, 30, 25, 20, 15, 10, 5, and 0 were used to determine the detection limit.
[0042] The reaction system included 10 μL of 2X TaqMan Environmental Master Mix 2.0 (AppliedBiosystems, Foster City, CA, USA), upstream primer AV4143F at a final concentration of 500 nM, downstream primer AV4143R at a final concentration of 500 nM, AV4143P1 probe at a final concentration of 250 nM, 2 μL of DNA template, add sterile water to 20 μL.
[0043] Reactions were run on an ABI 7...
Embodiment 3
[0048] Example 3 Sensitivity and specificity experiments
[0049] (1) Sample collection: Same as Example 1.
[0050] (2) Extraction of DNA: the same as in Example 1.
[0051] (3) Detection:
[0052] The experimental group adopted the AV4143P1 probe of the present invention;
[0053] The control group used the AV4143P probe whose nucleotide sequence was AGGTGGTTTTGCTATCGCTTT; SEQ ID NO.6.
[0054] The reaction system included 10 μL of 2X TaqMan Environmental Master Mix 2.0 (AppliedBiosystems, Foster City, CA, USA), upstream primer AV4143F at a final concentration of 500 nM, downstream primer AV4143R at a final concentration of 500 nM, AV4143P1 probe at a final concentration of 250 nM, 2 μL of DNA template, add sterile water to 20 μL.
[0055] Reactions were run on an ABI 7500 real-time qPCR (Applied Biosystems, Foster City, CA, USA) instrument. The reaction procedure was carried out by a two-step method. The conditions were 50°C pre-denaturation for 2 min; 95°C pre-denatur...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


