Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of poultry manure pollution fluorescent quantitative PCR detection probe and detection method

A technology for fluorescence quantification and detection of probes, which is applied in biochemical equipment and methods, microbe determination/inspection, DNA/RNA fragments, etc. It can solve the problems of different attenuation rates of indicators, differences in the adaptability of microbial traceability technology, markers, etc. Not suitable for use and other problems, to achieve the effect of good specificity and high sensitivity

Active Publication Date: 2022-05-24
UNIVERSITY OF CHINESE ACADEMY OF SCIENCES
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are regional differences in the application of this technology at present, which are mainly caused by two reasons: (1) In terms of hosts, due to the differences in the ways of raising livestock and poultry in different regions, microorganisms adapt to the intestinal environment of hosts in different regions. In the process of genetic diversity, genetic diversity may be generated, which may cause the phenotype or genotype of microbial traceability indicators to vary; Complexity makes the adaptability of microbial traceability technology vary in different regions
Currently, most poultry fecal contamination markers are invented abroad, so these markers are not suitable for use in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of poultry manure pollution fluorescent quantitative PCR detection probe and detection method
  • A kind of poultry manure pollution fluorescent quantitative PCR detection probe and detection method
  • A kind of poultry manure pollution fluorescent quantitative PCR detection probe and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of AV4143P1 probe

[0023] (1) Sample collection

[0024] To make the samples representative, a total of 162 samples were collected from 5 regions in Inner Mongolia, Beijing, Henan, Jiangxi and Guangdong, including 119 samples from poultry pollution sources and 43 samples from non-avian pollution sources. ①119 poultry pollution source samples, including 14 poultry litter samples, 75 chicken manure samples, 10 duck manure samples, 14 goose manure samples and 6 pigeon manure samples. ②43 samples from non-avian sources, including 10 pig feces, 6 dog feces, 6 horse feces, 5 donkey feces, 6 cattle feces, 5 goat feces and 5 sheep feces. After sample collection is complete, use dry ice to transport the samples back to the laboratory as soon as possible and store them in a -80°C freezer.

[0025] (2) DNA extraction

[0026] ① Take 180-220 mg of sample, and use QIAamp DNA Stool Mini Kit (QIAGEN, Hilden, Germany) DNA extraction kit to extract sample DNA ...

Embodiment 2

[0038] Example 2 Determination of detection limit

[0039] The detection limit is the lowest copy number detected in the target host sample. Plasmid DNA samples (7.45 × 10) were diluted in six 10-fold serial 8 -7.45×10 3 Copies) as the standard, determine the standard curve, and obtain the slope, y-axis intercept and R of the standard curve2 .

[0040] The formula for calculating the reaction efficiency is: E=10 (1 / -slope) -1

[0041] Plasmid DNA samples with copy numbers of 600, 400, 300, 200, 100, 60, 50, 40, 35, 30, 25, 20, 15, 10, 5, and 0 were used to determine the detection limit.

[0042] The reaction system included 10 μL of 2X TaqMan Environmental Master Mix 2.0 (AppliedBiosystems, Foster City, CA, USA), upstream primer AV4143F at a final concentration of 500 nM, downstream primer AV4143R at a final concentration of 500 nM, AV4143P1 probe at a final concentration of 250 nM, 2 μL of DNA template, add sterile water to 20 μL.

[0043] Reactions were run on an ABI 7...

Embodiment 3

[0048] Example 3 Sensitivity and specificity experiments

[0049] (1) Sample collection: Same as Example 1.

[0050] (2) Extraction of DNA: the same as in Example 1.

[0051] (3) Detection:

[0052] The experimental group adopted the AV4143P1 probe of the present invention;

[0053] The control group used the AV4143P probe whose nucleotide sequence was AGGTGGTTTTGCTATCGCTTT; SEQ ID NO.6.

[0054] The reaction system included 10 μL of 2X TaqMan Environmental Master Mix 2.0 (AppliedBiosystems, Foster City, CA, USA), upstream primer AV4143F at a final concentration of 500 nM, downstream primer AV4143R at a final concentration of 500 nM, AV4143P1 probe at a final concentration of 250 nM, 2 μL of DNA template, add sterile water to 20 μL.

[0055] Reactions were run on an ABI 7500 real-time qPCR (Applied Biosystems, Foster City, CA, USA) instrument. The reaction procedure was carried out by a two-step method. The conditions were 50°C pre-denaturation for 2 min; 95°C pre-denatur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a poultry feces pollution fluorescent quantitative PCR detection probe and a detection method, which belong to the technical field of biological detection. The invention provides a poultry feces pollution fluorescent quantitative PCR detection probe, the probe nucleotide sequence is 5'-AGATGGTTCTGCTATCGCTTT-3'; SEQ ID NO.1. Compared with the prior art, the beneficial effects obtained by the present invention are as follows: it solves the current situation that poultry fecal pollutant markers designed abroad cannot be used in our country, and provides a poultry biomarker suitable for use in my country with high sensitivity and good specificity. Real-time quantitative PCR detection probe for fecal contamination. The sensitivity of the probe designed by the invention reaches 86.55%, and the specificity reaches 93.48%.

Description

technical field [0001] The invention relates to the technical field of biological detection, and more particularly to a fluorescent quantitative PCR detection probe and detection method for poultry feces pollution. Background technique [0002] With the prosperity and development of poultry farming, the production of poultry manure is increasing day by day. Part of the excrement will flow into the surface water due to rain erosion or human mismanagement, causing certain pollution to the water environment. Feces contain a large number of pathogenic microorganisms that are harmful to the human body, which can cause diseases such as diarrhea and acute gastroenteritis. Many fecal-derived pathogens can proliferate in vitro in environmental water, leading to waterborne transmission of pathogenic microorganisms. How to quickly identify whether there is poultry manure pollution in water bodies has important guiding significance for water body management and protection. [0003] M...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6851C12Q1/6888C12N15/11
CPCC12Q1/6851C12Q1/6888C12Q2531/113C12Q2561/101
Inventor 余志晟梁红霞张洪勋刘如铟
Owner UNIVERSITY OF CHINESE ACADEMY OF SCIENCES