Supercharge Your Innovation With Domain-Expert AI Agents!

CRISPR-mediated system for rapidly detecting function of plant gene

A plant and rapid technology, applied in the field of gene editing, can solve problems such as inability to obtain plants, and achieve the effect of shortening the probability of off-target failure, facilitating cloning, and shortening the time-consuming of experiments.

Inactive Publication Date: 2020-05-12
HORTICULTURE INST OF XINJIANG ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, the existing VIGS technology can observe the influence of the target gene on the phenotype in the contemporary era, but it is impossible to obtain plants with complete gene knockouts; and the cultivation of mutant plants through the CRISPR / Cas system requires several generations to obtain stable inheritance. homozygous mutant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-mediated system for rapidly detecting function of plant gene
  • CRISPR-mediated system for rapidly detecting function of plant gene
  • CRISPR-mediated system for rapidly detecting function of plant gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Construction of Cas protein transgenic plants

[0044] The processed tomato M82 (Tomato Genetics Resource Center, TGRC) and SpCas9 gene carrier (Addgene Company) used in this experiment, the tobacco rattle virus vector materials pPTRV1 and pPTRV2 were quoted from China Agricultural University, the plant gene expression vector pCAM1303, Agrobacterium GV3101 and Agrobacterium EHA105 was self-stored in the laboratory, the seamless cloning kit was purchased from Beijing Tiangen Biochemical Technology Company, and gRNA synthesis was entrusted to Sangon Biotechnology Co., Ltd.

[0045] Firstly, SpCas9 and pCAM1303 were linearized by PCR and double enzyme digestion, respectively, and the SpCas9 gene used for transformation was connected into pCAM1303 using a seamless cloning kit (Beijing Tiangen), so that SpCas9 was located behind the 35S promoter.

[0046] Homologous sequences were loaded on the circular plant gene expression vector pCAM1303 after enzyme digestion a...

Embodiment 2

[0078] Example 2 Construction of pTRV2-gRNA recombinant vector

[0079] According to the tomato PDS gene fragment, two PDS gene gRNA sequences are designed on the website (https: / / www.genscript.com / gRNA-design-tool.html), and the gRNA-PDS sequence is as SEQ ID NO in the sequence listing. 5 (including restriction sites XbaI and KpnI).

[0080] gRNA-PDS序列:ctagtctaga ctagaacaaa gcaccagtgg tctagtggta gaatagtaccctgccacggt acagacccgg gttcgattcc cggctggtgc aggcatgcaa agtctctcag gagggtttaagagctatgct ggaaacagca tagcaagttt aaataaggct agtccgttat caacttgaaa aagtggcaccgagtcggtgc aacaaagcac cagtggtcta gtggtagaat agtaccctgc cacggtacag acccgggttcgattcccggc tggtgcagag tgacggtagt gcaatcgagg gtttaagagc tatgctggaa acagcatagcaagtttaaat aaggctagtc cgttatcaac ttgaaaaagt ggcaccgagt cggtgcttttt tttttcggggtaccccg(SEQ ID NO.5)。

[0081] The synthetic gRNA-PDS was connected to the VIGS viral vector pTRV2 by double enzyme digestion to construct the pTRV2-gRNA-PDS recombinant vector (ie, recombinant viral ...

Embodiment 3

[0082] Example 3 VIGS silences the PDS gene of SpCas9 transgenic plants

[0083] The four-leaf stage of the SpCas9 transgenic plant cultured in the greenhouse (the SpCas9 transgenic plant is processed tomato M82) was used as the experimental material, and the seedling cultivation conditions were 23°C during the day, 18°C ​​at night, 70% relative humidity, and 16 hours of light / darkness per day. / 8h.

[0084] Adjust the OD600 of the Agrobacterium GV3101 bacterial solution to 2.0, and after standing at room temperature for 3 hours, inject the bacterial solution to the back of the fourth true leaf of SpCas9 transgenic plant processing tomato M82 with a disposable syringe with the needle removed. After one week, albino white spots were observed on the new leaves of infected plants, such as Figure 5 shown. In the experiment, a total of 20 plants were transformed into Agrobacterium GV3101 bacterial liquid, and 14 albino seedlings were obtained, and the transformation rate was as ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR-mediated system for rapidly detecting the function of a plant gene. The system is characterized in that a recombinant virus vector containing a target gene gRNA sequence is transferred into a Cas protein transgenic plant. The invention overcomes the technical defect that at least two to three generations of plant growth cycle are needed to obtain a homozygous mutant by adopting a CRISPR / Cas system in the prior plant research field, and provides a system capable of rapidly researching the function of a plant gene. A recombinant virus vector containing a gRNA sequence is transferred into a transgenic plant into which a Cas gene is transferred, so that the function of a target gene can be detected at the current generation. In addition, the recombinant virus vector containing the gRNA sequence is transferred, an sgRNA is formed in an infected plant, the Cas9 is guided to cut the target gene, and the seed subjected to gene mutation can be obtained, so thatexperiment time consumption and probability of miss failure are greatly shortened.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and more specifically relates to a system for rapidly detecting plant gene functions mediated by CRISPR. Background technique [0002] The CRISPR (Clustered Regularly Interspaced ShortPalind-romic Repeats) and CRISPR-associated nuclease Cas (CRISPR-associated nuclease) system is an adaptive immune defense mechanism formed during the long-term evolution of bacteria and archaea. . The system can recognize its own sequence and foreign invading DNA fragments, and cut off the foreign fragments, so as to achieve the purpose of protecting itself. Scientists have developed this immune mechanism into a gene-directed editing technology, which is widely used in biological and medical research. The CRISPR / Cas system, through the guide RNA (guide RNA, gRNA) sequence, on the one hand, specifically recognizes the sequence of the genomic DNA target site to be edited, and on the other hand guides the Cas p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/83A01H5/10
CPCC07K14/415C12N15/8218
Inventor 唐亚萍杨涛王柏柯杨生保李宁王娟张国儒帕提古丽·艾斯木托拉余庆辉
Owner HORTICULTURE INST OF XINJIANG ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com