Method for detecting Mycobacterium tuberculosis from sputum
A technology of Mycobacterium tuberculosis and DNA molecules is applied in the field of detecting Mycobacterium tuberculosis from sputum, tuberculosis diagnostic reagents and kits, and can solve the problems of complex chip preparation, low sensitivity, cumbersome sample preparation and labeling, etc. , to achieve the effect of strong RNase (RNase) activity, high specific nucleic acid detection method, stability and practicability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Embodiment 1, the method for identifying and detecting Mycobacterium tuberculosis
[0066] 1. Preparation of Lw Cas13a protein
[0067] The amino acid sequence of the Lw Cas13a protein is sequence 2 in the sequence listing, and the nucleotide sequence of the gene encoding it is sequence 1 in the sequence listing.
[0068] Lw Cas13a protein can be prepared by prokaryotic expression and purification, the specific method is as follows:
[0069] 1. Induced expression of Lw Cas13a protein
[0070] The LwCas13a protein expression plasmid Twinstrep-SUMO-huLwCas13a was purchased from Addgene (ID: 90097). This plasmid contains the LwCas13a protein coding gene and expresses the recombinant protein LwCas13a. The LwCas13a protein contains 1,152 amino acids and is about 150kD in size. The recombinant protein LwCas13a In order to carry two tags (His-tag and Strep-tag) at the end of the LwCas13a protein. The SUMO restriction site can be used to separate the protein from the solid ph...
Embodiment 2
[0164] Example 2, PCR-CRISPR identification of Mycobacterium tuberculosis
[0165] 1. Amplification of the target detection product of the bacteria to be tested
[0166] Roche’s medium was placed in a 37°C incubator for solid culture for 3 weeks, and the standard strain of Mycobacterium tuberculosis H37RV (ATCC27294) was cultivated, and the strain was scraped and ground; the OD value of the strain was measured, and the final quantification was 1OD, (0.2OD is equivalent to 10 8 copies / ul) carry out 10-fold serial dilution to bacterial strain, obtain concentration 10 0 -10 5 copies / ul of H37RV bacteria solution.
[0167] Separately extract the concentration of 10 0 -10 5 The genomic DNA of the H37RV bacterial liquid in copies / ul was used as a template, and 6110-crDNA-R: 5’ATCTCGTCCAGCGCCGCTT3’ and 6110-crDNA-F: 5’TAATACGACTCACTATAGGGGATTTAGACTACCCCAA 3’ primers were used for PCR amplification to obtain target detection products with different concentrations.
[0168] 2. PCR...
Embodiment 3
[0173] Example 3, PCR-CRISPR identification and detection of whether Mycobacterium tuberculosis is contained in clinical samples
[0174] 1. Amplification of the target detection product of the sample to be tested
[0175] Sputum samples from 100 cases of Mycobacterium tuberculosis infection confirmed by sputum smear and geneXpert test were taken from Beijing Changping District Tuberculosis Prevention and Control Institute (SP, xpert test positive).
[0176] ① Digested sputum: Take 1ml of sputum sample and put it in a 15ml centrifuge tube. According to the condition of sputum, add the sample digestive solution (Xpert digestive solution ), shake vigorously 10-20 times. After standing still for 5-10 minutes, shake vigorously again 10-20 times, and let stand at room temperature for 15 minutes to fully liquefy the sample.
[0177] ② Centrifugation and washing: 1.5ml of the fully digested sample was placed in a 2ml centrifuge tube at 4°C and centrifuged at 12000g for 15 minutes. ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



