Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for detecting Mycobacterium tuberculosis from sputum

A technology of Mycobacterium tuberculosis and DNA molecules is applied in the field of detecting Mycobacterium tuberculosis from sputum, tuberculosis diagnostic reagents and kits, and can solve the problems of complex chip preparation, low sensitivity, cumbersome sample preparation and labeling, etc. , to achieve the effect of strong RNase (RNase) activity, high specific nucleic acid detection method, stability and practicability

Active Publication Date: 2020-05-26
BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +1
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

(1) Bacteriological diagnosis: (1) smear: low sensitivity of acid-fast staining; (2) modified Roche culture: it takes a long time to observe for 8 weeks, and the sensitivity is not high; (3) BACTEC MGIT960 rapid culture system: 1-3 weeks, expensive instruments and reagents; (2) Molecular biology diagnosis: (1) XpertMtb / RIF detection: Mtb-specific real-time PCR, which is a fully automatic test that integrates specimen processing, PCR, and rifampicin resistance gene detection Rapid detection method, expensive instruments and reagents; (2) melting curve: used to diagnose drug-resistant tuberculosis; (3) gene chip technology: the preparation of the chip is relatively complicated, sample preparation and labeling are cumbersome, the detection cost is high, and expensive special (4) Linear probe technology: It can detect mutations of INH and RFP drug resistance genes at the same time, which is used for multidrug-resistant tuberculosis; (5) Loop-mediated isothermal amplification technology (LAMP): for the analysis of tuberculosis (6) Simultaneous constant temperature amplification technology: detecting RNA fragments of Mycobacterium tuberculosis to diagnose tuberculosis
[0003] The current detection methods all have problems such as long detection time, high cost, low accuracy and specificity. Molecular biological diagnostic methods have the characteristics of fast and simple, but the current molecular biological methods still have low sensitivity, The problem of low specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting Mycobacterium tuberculosis from sputum
  • Method for detecting Mycobacterium tuberculosis from sputum
  • Method for detecting Mycobacterium tuberculosis from sputum

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1, the method for identifying and detecting Mycobacterium tuberculosis

[0066] 1. Preparation of Lw Cas13a protein

[0067] The amino acid sequence of the Lw Cas13a protein is sequence 2 in the sequence listing, and the nucleotide sequence of the gene encoding it is sequence 1 in the sequence listing.

[0068] Lw Cas13a protein can be prepared by prokaryotic expression and purification, the specific method is as follows:

[0069] 1. Induced expression of Lw Cas13a protein

[0070] The LwCas13a protein expression plasmid Twinstrep-SUMO-huLwCas13a was purchased from Addgene (ID: 90097). This plasmid contains the LwCas13a protein coding gene and expresses the recombinant protein LwCas13a. The LwCas13a protein contains 1,152 amino acids and is about 150kD in size. The recombinant protein LwCas13a In order to carry two tags (His-tag and Strep-tag) at the end of the LwCas13a protein. The SUMO restriction site can be used to separate the protein from the solid ph...

Embodiment 2

[0164] Example 2, PCR-CRISPR identification of Mycobacterium tuberculosis

[0165] 1. Amplification of the target detection product of the bacteria to be tested

[0166] Roche’s medium was placed in a 37°C incubator for solid culture for 3 weeks, and the standard strain of Mycobacterium tuberculosis H37RV (ATCC27294) was cultivated, and the strain was scraped and ground; the OD value of the strain was measured, and the final quantification was 1OD, (0.2OD is equivalent to 10 8 copies / ul) carry out 10-fold serial dilution to bacterial strain, obtain concentration 10 0 -10 5 copies / ul of H37RV bacteria solution.

[0167] Separately extract the concentration of 10 0 -10 5 The genomic DNA of the H37RV bacterial liquid in copies / ul was used as a template, and 6110-crDNA-R: 5’ATCTCGTCCAGCGCCGCTT3’ and 6110-crDNA-F: 5’TAATACGACTCACTATAGGGGATTTAGACTACCCCAA 3’ primers were used for PCR amplification to obtain target detection products with different concentrations.

[0168] 2. PCR...

Embodiment 3

[0173] Example 3, PCR-CRISPR identification and detection of whether Mycobacterium tuberculosis is contained in clinical samples

[0174] 1. Amplification of the target detection product of the sample to be tested

[0175] Sputum samples from 100 cases of Mycobacterium tuberculosis infection confirmed by sputum smear and geneXpert test were taken from Beijing Changping District Tuberculosis Prevention and Control Institute (SP, xpert test positive).

[0176] ① Digested sputum: Take 1ml of sputum sample and put it in a 15ml centrifuge tube. According to the condition of sputum, add the sample digestive solution (Xpert digestive solution ), shake vigorously 10-20 times. After standing still for 5-10 minutes, shake vigorously again 10-20 times, and let stand at room temperature for 15 minutes to fully liquefy the sample.

[0177] ② Centrifugation and washing: 1.5ml of the fully digested sample was placed in a 2ml centrifuge tube at 4°C and centrifuged at 12000g for 15 minutes. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting Mycobacterium tuberculosis from sputum. The invention provides a kit. The kit comprises the following substances as represented by 1) to 3): 1) amplifying a primer pair containing a 6110-crRNA target sequence; 2) 6110-crRNA with the target sequence represented by sequence 3; and 3) an LwCas13a protein, wherein the amino acid sequence of the LwCas13a protein is composed of amino acid residues represented by a sequence 2 in the sequence table. On the basis of a CRISPR-Cas13a detection technology, a PCR amplification technology and the CRISPR-Cas13adetection technology are combined for the first time, and the PCR technology is more suitable for clinical nucleic acid detection due to the fact that the technology is stable and high in practicability. The novel high-sensitivity and high-specificity nucleic acid detection method is established.

Description

technical field [0001] The invention belongs to the field of diagnostic reagents, relates to a tuberculosis diagnostic reagent and a kit, in particular to a method for detecting mycobacterium tuberculosis from sputum. Background technique [0002] Globally, tuberculosis is still one of the top ten causes of death. According to the report of the World Health Organization (WHO), there were an estimated 10 million new tuberculosis patients in the world in 2017, and an estimated 889,000 new tuberculosis patients in China. The tuberculosis epidemic is serious, and the diagnosis and treatment of tuberculosis is still imminent. At present, both bacteriological and immunological diagnosis of tuberculosis are faced with many problems, such as sensitivity and specificity, speed and convenience of detection, and cost. At this stage, the diagnostic technology for detecting Mycobacterium tuberculosis in clinical samples is a comprehensive clinical diagnosis. The current gold standard f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12R1/32
CPCC12Q1/689C12Q1/6851C12Q2600/158C12Q2600/178C12Q2531/113C12Q2521/327C12Q2563/107C12Q2545/113Y02A50/30
Inventor 李传友刘毅张旭霞于佳佳
Owner BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More