Chlorsulfuron-methyl-degrading enzyme kj-gst, its coding gene kj-gst and application
A chlorimuron-methyl degrading enzyme, kj-gst technology, applied in the direction of enzymes, biochemical equipment and methods, DNA / RNA fragments, etc., can solve the problem of insignificant effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0016] The gene knockout of embodiment 1 gene Kj-gst
[0017] 1) Amplification of the gene Kj-gst and amplification of the targeting linear cassette
[0018] The upstream primer of the amplified gene Kj-gst is
[0019] 5'ATGCTGACGGTACATCATCTTAATCAATC3'
[0020] Downstream primers are:
[0021] TCAGGCGCCGGGTAAGG)
[0022] The primers used to verify whether the knockout is successful are: upstream primers:
[0023] 5'TAACCAGACGATGCGCAAACG3'
[0024] Downstream primers are:
[0025] 5'TGGCATCTGCCGTCGCTTTT 3'
[0026] The homologous targeting linear cassette was amplified using the vector pKD4 as a template, and the upstream primers used were
[0027] 5'CGCTAACAATTTTTTAGTGAGTTGCTTTCATTTATCGACGTCATCGGATCCGCTGATATCTGTGTAGGCTGGAGCTG3'
[0028] The downstream primer is
[0029] 5'TTTTCCCGGCAATGAGCGCCTGTTTCTATAGTTAATTTGAACAAACTACGGGAGAGGCTCATCCTCCTTAGTTCCTATTCC3'
[0030] The reaction system is 10mmol / L dNTP Mixture1μL; 5×PCR buffer10μL; upstream and downstream primers 2.5μL ...
Embodiment 2
[0046] Example 2 Knockout Gene Complementation
[0047] 1) Transformation of the complementing vector plasmid pLI50
[0048] The Escherichia coli DH5α containing the plasmid pLI50 was taken out from the -80°C refrigerator (the Escherichia coli DH5α containing the plasmid pLI50 was purchased from Beijing Huayueyang Biological Company), and the recovered cells were cultured by streaking. The recovered bacterial solution was inoculated into 20 mL of LB medium and cultured overnight at 30°C and 200 rpm, and the plasmid pLI50 was extracted the next day using a plasmid extraction kit. The extracted plasmid was subjected to double enzyme digestion, the restriction sites were HindⅢ and EcoRI respectively, and it was connected with the Kj-gst gene fragment amplified by PCR in step 1). The upstream primer for double digestion of plasmid pLI50 is 5'GCGTCGAC-ATGCTGACGGTACATCATCTTAATCAATC3', and the downstream primer is 5'CCCAAGCTT-TCAGGCGCCGGGTAAGG3'. On the basis of the upstream and do...
Embodiment 3
[0053] Example 3 Degradability test of knockout mutants and complementation mutants to chlorimuron-methyl
[0054] 1) Preparation of inoculum
[0055] Three bacterial solutions of 2N3 wild type, 2N3 Kj-gst knockout mutant (obtained in Example 1), and 2N3 Kj-gst anaplerotic mutant (obtained in Example 2) were shaken separately. The three bacterial solutions were washed three times with sterile water, so that the final OD values of the three bacterial solutions were all 0.5.
[0056] 2) Preparation of inorganic salt medium
[0057] The formula of inorganic salt medium is: glucose 5g, KH 2 PO 4 1.0g, MgSO 4 ·7H 2 O 0.2g, K 2 HPO 4 1.0g, NaCl 0.2g, NH 4 NO 3 1.6g, add water to make up to 1L. Add chlorimuron-methyl solid powder to make the concentration of chlorimuron-methyl in the medium finally 10mg / mL.
[0058] 3) Degradability test
[0059] The prepared inorganic salt medium was respectively inoculated with the same amount of three different bacterial solutions...
PUM
| Property | Measurement | Unit |
|---|---|---|
| melting point | aaaaa | aaaaa |
| density | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



