Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chlorsulfuron-methyl-degrading enzyme kj-gst, its coding gene kj-gst and application

A chlorimuron-methyl degrading enzyme, kj-gst technology, applied in the direction of enzymes, biochemical equipment and methods, DNA / RNA fragments, etc., can solve the problem of insignificant effect

Active Publication Date: 2022-04-19
JILIN AGRICULTURAL UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There have been some reports about strains degrading chlorimuron-methyl, but most of the effects are not significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlorsulfuron-methyl-degrading enzyme kj-gst, its coding gene kj-gst and application
  • Chlorsulfuron-methyl-degrading enzyme kj-gst, its coding gene kj-gst and application
  • Chlorsulfuron-methyl-degrading enzyme kj-gst, its coding gene kj-gst and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] The gene knockout of embodiment 1 gene Kj-gst

[0017] 1) Amplification of the gene Kj-gst and amplification of the targeting linear cassette

[0018] The upstream primer of the amplified gene Kj-gst is

[0019] 5'ATGCTGACGGTACATCATCTTAATCAATC3'

[0020] Downstream primers are:

[0021] TCAGGCGCCGGGTAAGG)

[0022] The primers used to verify whether the knockout is successful are: upstream primers:

[0023] 5'TAACCAGACGATGCGCAAACG3'

[0024] Downstream primers are:

[0025] 5'TGGCATCTGCCGTCGCTTTT 3'

[0026] The homologous targeting linear cassette was amplified using the vector pKD4 as a template, and the upstream primers used were

[0027] 5'CGCTAACAATTTTTTAGTGAGTTGCTTTCATTTATCGACGTCATCGGATCCGCTGATATCTGTGTAGGCTGGAGCTG3'

[0028] The downstream primer is

[0029] 5'TTTTCCCGGCAATGAGCGCCTGTTTCTATAGTTAATTTGAACAAACTACGGGAGAGGCTCATCCTCCTTAGTTCCTATTCC3'

[0030] The reaction system is 10mmol / L dNTP Mixture1μL; 5×PCR buffer10μL; upstream and downstream primers 2.5μL ...

Embodiment 2

[0046] Example 2 Knockout Gene Complementation

[0047] 1) Transformation of the complementing vector plasmid pLI50

[0048] The Escherichia coli DH5α containing the plasmid pLI50 was taken out from the -80°C refrigerator (the Escherichia coli DH5α containing the plasmid pLI50 was purchased from Beijing Huayueyang Biological Company), and the recovered cells were cultured by streaking. The recovered bacterial solution was inoculated into 20 mL of LB medium and cultured overnight at 30°C and 200 rpm, and the plasmid pLI50 was extracted the next day using a plasmid extraction kit. The extracted plasmid was subjected to double enzyme digestion, the restriction sites were HindⅢ and EcoRI respectively, and it was connected with the Kj-gst gene fragment amplified by PCR in step 1). The upstream primer for double digestion of plasmid pLI50 is 5'GCGTCGAC-ATGCTGACGGTACATCATCTTAATCAATC3', and the downstream primer is 5'CCCAAGCTT-TCAGGCGCCGGGTAAGG3'. On the basis of the upstream and do...

Embodiment 3

[0053] Example 3 Degradability test of knockout mutants and complementation mutants to chlorimuron-methyl

[0054] 1) Preparation of inoculum

[0055] Three bacterial solutions of 2N3 wild type, 2N3 Kj-gst knockout mutant (obtained in Example 1), and 2N3 Kj-gst anaplerotic mutant (obtained in Example 2) were shaken separately. The three bacterial solutions were washed three times with sterile water, so that the final OD values ​​of the three bacterial solutions were all 0.5.

[0056] 2) Preparation of inorganic salt medium

[0057] The formula of inorganic salt medium is: glucose 5g, KH 2 PO 4 1.0g, MgSO 4 ·7H 2 O 0.2g, K 2 HPO 4 1.0g, NaCl 0.2g, NH 4 NO 3 1.6g, add water to make up to 1L. Add chlorimuron-methyl solid powder to make the concentration of chlorimuron-methyl in the medium finally 10mg / mL.

[0058] 3) Degradability test

[0059] The prepared inorganic salt medium was respectively inoculated with the same amount of three different bacterial solutions...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
densityaaaaaaaaaa
Login to View More

Abstract

A chlorimuron-methyl-degrading enzyme Kj-GST, its coding gene Kj-gst and its application belong to the technical field of microbial genetic engineering. We successfully cloned the gene KJ‑gst from Klebsiella jilinsis 2N3, and the comparison results in GenBank showed that the gene is a glutathione S-transferase gene with a full length (from the start codon to the stop codon) of 669bp, encoding 222 amino acids. The chlorimuron-methyl degrading enzyme Kj-GST of the present invention can efficiently degrade chlorimuron-methyl, and simple analysis shows that it can hydrolyze chlorimuron-methyl to produce o-sulfonic acid imide and 2-amino-6-methoxy base pyrimidine. The gene KJ-gst can be used to construct transgenic microorganisms or plants that degrade chlorimsulfuron-methyl, and can also be used to produce enzyme preparations that degrade chlorimsulfuron-methyl, and can be used to eliminate chlorimuron-methyl residues in soil, water and agricultural products.

Description

technical field [0001] The invention belongs to the technical field of microbial genetic engineering, and in particular relates to a chlorimuron-methyl-degrading enzyme Kj-GST, its coding gene Kj-gst and its application. Background technique [0002] Sulfonylurea herbicides are an important class of herbicides for the control of major crop weeds worldwide. Sulfonylurea herbicides control the growth of weeds in farmland by inhibiting the synthesis of ethoxyacid synthase (AHAS) in plants. AHAS is a key enzyme in the biosynthetic pathway of valine, leucine and isoleucine in bacteria, fungi and plants. Sulfonylurea herbicides have the characteristics of high efficiency, low dosage, and multi-species selectivity, and have developed rapidly in recent years. The chemical name of chlorimuron-methyl is 2-(4-chloro-6-methoxypyrimidin-2-ylcarbamoylsulfamoyl)ethyl benzoate, which belongs to a kind of sulfonylurea herbicides and is colorless Crystal, melting point 181°C, density 1.51g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/00C12N15/52A62D3/02A62D101/04A62D101/28A62D101/26
CPCC12N9/00A62D3/02A62D2101/04A62D2101/28A62D2101/26
Inventor 张浩张思胜张程张祥辉刘金亮潘洪玉
Owner JILIN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com