Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of miRNA 200 cluster as marker for diagnosing and/or treating Alzheimer's disease

A technology for Alzheimer's disease, hsa-mir-200a, applied in the determination/testing of microorganisms, medical preparations containing active ingredients, drug combinations, etc., can solve the problem of lack of early screening methods, ineffective AD, complex pathogenesis

Inactive Publication Date: 2020-06-12
MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there are mainly the following problems in the prevention and treatment of AD: the lack of simple and non-invasive early screening methods; the pathogenesis is complex, and the effect of single-target drugs on AD is not obvious
Studies have shown that presenilin 1 (PSEN1) gene, presenilin 2 (PSEN2) gene and APP gene mutations are closely related to the occurrence and development of familial AD, which can be found through early genetic screening, but account for most of the sporadic AD There is no related gene report for AD, which brings great difficulty to the screening and prevention of AD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miRNA 200 cluster as marker for diagnosing and/or treating Alzheimer's disease
  • Application of miRNA 200 cluster as marker for diagnosing and/or treating Alzheimer's disease
  • Application of miRNA 200 cluster as marker for diagnosing and/or treating Alzheimer's disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1. miRNA chip technology detects differential expression of miR-200a in brain tissue of AD model animals and wild-type animals

[0041] Select 1, 3, 6 and 9-month-old APP / PS1 double transgenic mice respectively, extract mouse brain tissue RNA and perform Hy3TM and Hy5TM fluorescent labeling on miRNA, the microRNA of the miRNA 200a cluster of the present invention is hsa-miR-200a , whose sequence is shown in SEQ ID NO.1: ccgggccccu gugagcaucu uaccggacag ugcuggauuu cccagcuugacucuaacacugucugguaac gauguucaaa ggugacccgc. Its default mature body (hsa-miR-200a-3p) sequence is shown in SEQ ID NO.2: uaacacuguc uggguaacgau gu. Among them, mature (hsa-miR-200a-3p) miRNA reverse transcription primer: SEQ ID NO.3: gtcgtatcca gtgcagggtc cgaggtattc gcactggatacgacacatcg; quantitative PCR (qPCR) forward primer: SEQ ID NO.4: gcgcgtaaca ctgtctggta a; reverse Primer: SEQ ID NO. 5: agtgcagggt ccgaggtatt. Then the sample was hybridized with miRCURYTM Array chip, the chip was scanne...

Embodiment 2

[0042] Example 2, expression changes of miR-200a in AD model cells

[0043] The Swedish-type mutant APP gene was stably transfected into SH-SY5Y cells to construct a stably transfected APPswe cell line. Under the stimulation of copper ions, APPswe cells will generate a large amount of Aβ, resulting in apoptosis, which is one of the commonly used cell models of AD. In the present invention, 300 μM copper ions are used to damage APPswe cells to establish an AD cell model, and cell RNA is extracted to detect the expression level of miR-200a. Such as figure 2 As shown in middle A, compared with normal control SH-SY5Y cells, the expression of miR-200a in APPswe cells was significantly down-regulated (mean±SEM, n=3, **P<0.01), and miR-200a was related to Aβ damage.

Embodiment 3

[0044] Example 3, the expression changes of miR-200a in AD model animals and natural aging animals

[0045] APP / PS1 mice are commonly used AD transgenic mouse models, and SAMP8 mice are natural aging mice, which are often used in aging-related research to detect the changing characteristics and related mechanisms of degenerative diseases. APP / PS1 double transgenic mice aged 3, 6, and 9 months and their wild-type (WT) control mice (purchased from the Model Animal Research Institute of Nanjing University), as well as SAMP8 mice and their control mice (SAMR1) ( The hippocampal tissue RNA provided by the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences was used to detect the expression of miR-200a by qPCR. Such as figure 2 As shown in middle B, the expression of miR-200a in the hippocampus of 3, 6, and 9-month-old APP / PS1 mice showed a downward trend, and there was a significant difference between 9-month-old and WT mice of the same age ( mean±SEM, n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of miRNA 200 cluster as a marker for diagnosing and / or treating Alzheimer's disease. The invention provides application of miRNA 200 cluster micro RNA in diagnosis and treatment of Alzheimer's disease. AD model cells, AD model animals, naturally aged animals and clinical serum samples are used; the expression quantity of the miRNA 200 cluster in a human bodyis detected by using a primer aiming at the miRNA 200 cluster micro RNA marker; it is found that the expression of miRNA 200-cluster micro RNA in the Alzheimer's disease process is significantly reduced; Abeta generation, tau protein excessive phosphorylation and apoptosis-like degeneration in AD lesion are changed by targeting BACE1 and PRKACB, so that miRNA 200 cluster micro RNA can be used as anew Alzheimer's disease marker for auxiliary diagnosis and treatment of Alzheimer's disease.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of miRNA 200 clusters as markers for diagnosis and / or treatment of Alzheimer's disease. Background technique [0002] Alzheimer's disease (AD) is the most common form of dementia affecting the elderly aged 65 and over, and its main pathological features are senile plaques formed by extracellular amyloid deposition and hyperphosphorylation of intracellular tau protein The neurofibrillary tangles formed are mainly manifested as generalized dementia such as memory impairment, aphasia, apraxia, agnosia, impairment of visuospatial skills, executive dysfunction, and personality and behavior changes. The pathogenesis of AD is extremely complicated, and it is not fully understood at present, and the diagnostic methods and treatment methods are also extremely limited. The pathogenesis hypotheses of AD mainly include the Aβ theory, the abnormal phosphorylation hypothesis of ta...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883A61K45/00A61P25/28
CPCC12Q1/6883A61K45/00A61P25/28C12Q2600/178C12Q2600/106
Inventor 刘睿李卓荣姜海伦王琳琳曾利
Owner MEDICINE & BIOENG INST OF CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com