Unlock instant, AI-driven research and patent intelligence for your innovation.

A primer set for detecting human ocular surface adenovirus and its application

A primer set and adenovirus technology, applied in the biological field, achieve the effect of simple and fast operation, high requirements for detection conditions, and reduced operating costs

Active Publication Date: 2021-07-23
HE EYE HOSPITAL SHENYANG
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report of a diagnostic kit that can quickly and accurately detect human ocular surface adenovirus in a state of low reaction volume

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A primer set for detecting human ocular surface adenovirus and its application
  • A primer set for detecting human ocular surface adenovirus and its application
  • A primer set for detecting human ocular surface adenovirus and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Embodiment 1: the accuracy of the LAMP primer set provided by the present invention

[0069] The LAMP primer set provided by the present invention is used to detect Ad8, and the experiment is set as a negative control in combination with the samples to be tested. The LAMP primer set includes primers with the sequences shown in SEQ ID NO: 1-6.

[0070] F3:CTTACGCCGAACGAGTTTGA

[0071] B3:GCAACGGCCTTGTAATCCTT

[0072] FIP: GCATCTGGACCAGGAACCAGTC-GACGGGGAGGGCTATAACG

[0073] BIP: ATGTGCCTGAGGGCTACAAGG-CAACCACCTGCCTACTCATG

[0074] LPF: CTTGGTCATGTTGCATTGGGC

[0075] LPB: CTCCTTTCTTTCGCAACTTCCAGCC

[0076] The experimental groups are shown in Table 2:

[0077] Table 2 Experimental grouping and samples used

[0078] Sample to be tested 1 diseased corneal tissue negative control 1 normal corneal tissue Sample to be tested 2 Diseased vitreous cavity fluid negative control 2 normal vitreous cavity fluid Sample to be tested 3 Ad8-infected...

Embodiment 2

[0101] Embodiment 2: the sensitivity of the LAMP primer set provided by the present invention

[0102] Take the Ad8-type genomic plasmid, dilute the sample 10 times to make the concentration respectively 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, and use the above-mentioned diluted sample to detect the Sensitivity of LAMP primer sets.

[0103] For the experimental operation of LAMP, refer to Example 1 of the present invention.

[0104] The LAMP amplification system is:

[0105] Add the following components to a small PCR tube:

[0106]

[0107]

[0108] Experimental results such as figure 1 , as shown in Table 3:

[0109] Table 3 Sensitivity test results

[0110] sample concentration repeat 1 repeat 2 repeat 3 1ng / μl green green green 100pg / μl green green green 10pg / μl green green green 1pg / μl green green green 100fg / μl yellow yellow yellow 10fg / μl orange orange orange ...

Embodiment 3

[0112] Embodiment 3: the specificity of the LAMP primer set provided by the present invention

[0113] The primers for adenovirus type 8 were specifically detected using other viruses commonly found in ophthalmology, such as HSV type I, HSV type II, and varicella-zoster virus. The specific operation is the same as above, and the results show that the specific primers for adenovirus type 8 can only specifically amplify adenovirus type 8, but do not amplify other pathogenic microorganisms.

[0114] The test results are shown in Table 4, figure 2 Shown:

[0115] The specific detection result of table 4LAMP primer set

[0116]

[0117]

[0118] In order to further verify the experimental results of this example, 5 μL of amplification products were taken from each PCR tube, and subjected to 2% agarose gel electrophoresis at 90V for 45 minutes. Electrophoresis results such as image 3 , ladder-like amplification bands can be seen after electrophoresis for the green amplif...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biotechnology, in particular to a primer set for detecting human ocular surface adenovirus and its application. Experiments show that the primer set provided by the invention has good accuracy, sensitivity and specificity. The known samples were tested, and the results obtained were 100% matched with the expected ones, and the minimum detection limit could reach 100fg / μL, while the primer set was effective against other viruses, such as herpes simplex virus type I, herpes simplex virus type II, varicella zoster None of the herpes viruses produced non-specific amplification.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a primer set for detecting human ocular surface adenovirus and its application. Background technique [0002] Viral conjunctivitis is a common infectious eye disease and one of the most common causes of "red eye". It mainly manifests as acute follicular conjunctivitis, often accompanied by corneal lesions, and is highly contagious. It can be sporadic or epidemic . Mainly manifested in two types, namely epidemic keratoconjunctivitis and pharyngoconjunctival fever. [0003] Adenovirus (adenovirus, Ad) is a deoxyribonucleic acid (DNA) virus, which can be divided into 31 serotypes. At least 19 of the adenovirus serotypes have been reported as causative agents of epidemic or sporadic conjunctivitis or keratoconjunctivitis. Viral conjunctivitis caused by different types of adenoviruses may have different clinical manifestations; and the same clinical manifestations may also be caused by...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/70C12Q1/6844
CPCC12Q1/6844C12Q1/701C12Q2531/119C12Q2565/113
Inventor 王卓实高飞赵艳
Owner HE EYE HOSPITAL SHENYANG