A primer set for detecting human ocular surface adenovirus and its application
A primer set and adenovirus technology, applied in the biological field, achieve the effect of simple and fast operation, high requirements for detection conditions, and reduced operating costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0068] Embodiment 1: the accuracy of the LAMP primer set provided by the present invention
[0069] The LAMP primer set provided by the present invention is used to detect Ad8, and the experiment is set as a negative control in combination with the samples to be tested. The LAMP primer set includes primers with the sequences shown in SEQ ID NO: 1-6.
[0070] F3:CTTACGCCGAACGAGTTTGA
[0071] B3:GCAACGGCCTTGTAATCCTT
[0072] FIP: GCATCTGGACCAGGAACCAGTC-GACGGGGAGGGCTATAACG
[0073] BIP: ATGTGCCTGAGGGCTACAAGG-CAACCACCTGCCTACTCATG
[0074] LPF: CTTGGTCATGTTGCATTGGGC
[0075] LPB: CTCCTTTCTTTCGCAACTTCCAGCC
[0076] The experimental groups are shown in Table 2:
[0077] Table 2 Experimental grouping and samples used
[0078] Sample to be tested 1 diseased corneal tissue negative control 1 normal corneal tissue Sample to be tested 2 Diseased vitreous cavity fluid negative control 2 normal vitreous cavity fluid Sample to be tested 3 Ad8-infected...
Embodiment 2
[0101] Embodiment 2: the sensitivity of the LAMP primer set provided by the present invention
[0102] Take the Ad8-type genomic plasmid, dilute the sample 10 times to make the concentration respectively 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL, 10fg / μL, and use the above-mentioned diluted sample to detect the Sensitivity of LAMP primer sets.
[0103] For the experimental operation of LAMP, refer to Example 1 of the present invention.
[0104] The LAMP amplification system is:
[0105] Add the following components to a small PCR tube:
[0106]
[0107]
[0108] Experimental results such as figure 1 , as shown in Table 3:
[0109] Table 3 Sensitivity test results
[0110] sample concentration repeat 1 repeat 2 repeat 3 1ng / μl green green green 100pg / μl green green green 10pg / μl green green green 1pg / μl green green green 100fg / μl yellow yellow yellow 10fg / μl orange orange orange ...
Embodiment 3
[0112] Embodiment 3: the specificity of the LAMP primer set provided by the present invention
[0113] The primers for adenovirus type 8 were specifically detected using other viruses commonly found in ophthalmology, such as HSV type I, HSV type II, and varicella-zoster virus. The specific operation is the same as above, and the results show that the specific primers for adenovirus type 8 can only specifically amplify adenovirus type 8, but do not amplify other pathogenic microorganisms.
[0114] The test results are shown in Table 4, figure 2 Shown:
[0115] The specific detection result of table 4LAMP primer set
[0116]
[0117]
[0118] In order to further verify the experimental results of this example, 5 μL of amplification products were taken from each PCR tube, and subjected to 2% agarose gel electrophoresis at 90V for 45 minutes. Electrophoresis results such as image 3 , ladder-like amplification bands can be seen after electrophoresis for the green amplif...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


