Application of novel cucumber gene in improving photosynthesis and promoting plant growth and autotoxicity resistance
A technology of cucumber, genetics, applied in the fields of molecular biology and genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Using the existing Arabidopsis RNAi mutant library, on MS medium containing 50 mg / L hygromycin and 0.25 mM cinnamic acid (CA), about 1000 plants resistant to CA stress were screened from about 11200 RNAi transformed plants. mutant strains. In contrast, wild-type (WT) Arabidopsis plants showed obvious dwarfing and wilting symptoms on the same MS plate, and even caused some WT Arabidopsis plants to die ( figure 1 ). At the rosette stage of the mutant strains, we extracted the DNA genomes of the mutant strains of Arabidopsis, and used the specific primers NOS-60: CAACAGGATTCAATCTTAAGAAAC and Intron FW2: CATATTGCAAAGTCTGAAGACTC to amplify the interfering RNA in the transformed RNAi library of Arabidopsis thaliana by PCR. PCR products were recovered and ligated into pMD TM 19-T (TaKaRa, Code No.6013) vector, sequenced in order to obtain the mutant gene. According to BLAST sequencing results in NCBI, we found that a new Arabidopsis gene At5g16610 (NM_203062.2) with unknown...
Embodiment 2
[0034] Cloning of homologous gene of cucumber CsAt5g16610 / MTG13_5 gene and construction of pTRV-VIGS vector. In the Cucumber Genome Database ( http: / / cucurbitgenomics.org / ) in BLAST to obtain the homologous gene mRNA sequence of At5g16610 gene, design primers, and use cucumber cDNA as a template to clone the cucumber homologous gene CsAt5g16610 / MTG13_5, the coding sequence number in cucumber is Csa5G426400.1, this gene is a cucumber with unknown function new gene. At the 326-745bp of the cucumber CsAt5g16610 / MTG13_5 gene (the total length is 1905bp), the primers CsAt5g16610-pTRV2-F were designed: GCCTCCATGGGGATCCCTGGTGTGGCTGTAACTAA and CsAt5g16610-pTRV2-R: GCCTCGAPCRGACGCGTGAGCTCCTGTAGCAACCTTCTCTGT was used to amplify the DNA fragment and use GS as the template. In-FusionHD Cloning Kit (Takara, Cat.Nos.121416) ligated the recovered cucumber CsAt5g16610 gene VIGS fragment to the enzyme-cut TRV2 (restriction site is Sac I-BamH I) vector.
Embodiment 3
[0036] Preparation of cucumber pTRV-VIGS infection solution and transformation of cucumber. Transform GV3101 Agrobacterium with TRV1 and TRV2 plasmids linked with the VIGS fragment of cucumber CsAt5g16610 gene, mix them according to the ratio of TRV1:TRV2 of 1:1, and culture them at 28°C until the OD600 is 0.8, as the Agrobacterium infection solution. The prepared Agrobacterium infection solution was used to infect cucumber plants using the "cucumber cotyledon node method" to obtain cucumber pTRV-VIGS transformed cucumber plants, and WT and pTRV controls were set at the same time.
[0037] 10 days after Agrobacterium infection, WT cucumber, pTRV empty control and CsAt5g16610-VIGS cucumber plants were respectively set 0.25mM CA stress treatment and control, and the settings were as follows: (A) WT, (B) WT+CA, (C) pTRV empty control, (D) pTRV empty+CA, (E) CsAt5g16610-VIGS, (F) CsAt5g16610-VIGS+CA. After 14 days of CA treatment, photos were taken and index parameters were measu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



