Method for improving content of cordyceps polysaccharide in cordyceps militaris
A technology for Cordyceps militaris polysaccharide and Cordyceps militaris, applied in the field of increasing the content of Cordyceps militaris polysaccharide in Cordyceps militaris
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1 contains the recombinant Cordyceps militaris bacterial strain of gene gk
[0029] Table 1 Sources of materials
[0030]
[0031]
[0032] Table 2 Quality components of each culture medium
[0033]
[0034] The composition of the PDA medium is: 200g / L potato, 20g / L glucose, 15-20g / L agar, distilled water as a solvent, and natural pH.
[0035] The composition of the LB liquid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, solvent is distilled water, pH7.0.
[0036] The composition of the LB solid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 15-20g / L, solvent is distilled water, pH 7.0.
[0037] The composition of the IM medium: 0.145% KH 2 PO 4 , 0.205%K 2 HPO 4 , 0.06% MgSO 4 ·7H 2 O, 0.03% NaCl, 0.01‰CaCl 2 , 0.001‰FeSO 4 , 0.05% NH4 NO 3 , 5mL / L glycerin, 0.2% glucose, 5mL / L trace element stock solution, 40mL / L MES buffer solution (1mol / L, pH=5.5), solvent is distilled water; Described every 10ml trace element s...
Embodiment 2
[0067] Embodiment 2 contains the recombinant Cordyceps militaris bacterial strain of gene pgm
[0068] The extraction of Genomic DNA of Cordyceps militaris CGMCC 3.14242 is the same as in Example 1.
[0069] Utilize primer pgm-F2 / pgm-R2 to amplify and obtain the phosphoglucomutase gene pgm (SEQ ID NO.2) on the Genomic DNA of Cordyceps militaris, utilize -Uni Seamless Cloning and Assembly Kit linked the target gene fragment with the plasmid to obtain the recombinant vector PCAMBIA-PgpdA-pgm-Tcbh1-hph-PtrpC.
[0070] Table 5 Primers
[0071]
[0072]
[0073] Other operations are the same as in Example 1, obtain the recombinant Cordyceps militaris strain containing the gene pgm, take the extracted genomic DNA of the Cordyceps militaris hygromycin-resistant strain, and use HF-check / HR-check primers for PCR verification to check whether the transformation is successful , the result is as figure 2 Shown; Determination of total sugar content of transgenic strains, glucose...
Embodiment 3
[0074] Embodiment 3 contains the recombinant Cordyceps militaris strain of gene ugp
[0075] The extraction of Genomic DNA of Cordyceps militaris CGMCC 3.14242 is the same as in Example 1.
[0076] Utilize primer ugp-F3 / ugp-R3 to amplify and obtain the pyrophosphorylase gene ugp on the Genomic DNA of Cordyceps militaris, utilize -Uni Seamless Cloning and Assembly Kit Link the target gene fragment with the plasmid to obtain the recombinant vector PCAMBIA-PgpdA-ugp-Tcbh1-hph-PtrpC.
[0077] Table 6 Primers
[0078] ugp-F3 GCAGACATCACAATGGTTGTGGCAGGGGGGAGGAGGG ugp-R3 TTTCGCCACGGAGCTTAATGCTCAAGCAGGCGTAGCGAG Plasmid-F AGCTCCGTGGCGAAAGCCTGACGCA Plasmid-R CATTGTGATGTCTGCTCAAGCGGGGT HF-check CTATTCCTTTGCCCTCGGACGA HR-check ATGCCTGAACTCACCGCGACGT
[0079] Other operations are the same as in Example 1, obtain the recombinant Cordyceps militaris strain containing the gene ugp, take the extracted genomic DNA of the Cordyceps militaris hy...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



