Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for improving content of cordyceps polysaccharide in cordyceps militaris

A technology for Cordyceps militaris polysaccharide and Cordyceps militaris, applied in the field of increasing the content of Cordyceps militaris polysaccharide in Cordyceps militaris

Active Publication Date: 2020-07-28
ZHEJIANG UNIV OF TECH
View PDF4 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Overexpression of polysaccharide synthesis genes of Cordyceps militaris to increase the production of polysaccharides from Cordyceps militaris has not been reported in the literature

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving content of cordyceps polysaccharide in cordyceps militaris
  • Method for improving content of cordyceps polysaccharide in cordyceps militaris
  • Method for improving content of cordyceps polysaccharide in cordyceps militaris

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 contains the recombinant Cordyceps militaris bacterial strain of gene gk

[0029] Table 1 Sources of materials

[0030]

[0031]

[0032] Table 2 Quality components of each culture medium

[0033]

[0034] The composition of the PDA medium is: 200g / L potato, 20g / L glucose, 15-20g / L agar, distilled water as a solvent, and natural pH.

[0035] The composition of the LB liquid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, solvent is distilled water, pH7.0.

[0036] The composition of the LB solid medium: tryptone 10g / L, yeast extract 5g / L, NaCl 10g / L, agar 15-20g / L, solvent is distilled water, pH 7.0.

[0037] The composition of the IM medium: 0.145% KH 2 PO 4 , 0.205%K 2 HPO 4 , 0.06% MgSO 4 ·7H 2 O, 0.03% NaCl, 0.01‰CaCl 2 , 0.001‰FeSO 4 , 0.05% NH4 NO 3 , 5mL / L glycerin, 0.2% glucose, 5mL / L trace element stock solution, 40mL / L MES buffer solution (1mol / L, pH=5.5), solvent is distilled water; Described every 10ml trace element s...

Embodiment 2

[0067] Embodiment 2 contains the recombinant Cordyceps militaris bacterial strain of gene pgm

[0068] The extraction of Genomic DNA of Cordyceps militaris CGMCC 3.14242 is the same as in Example 1.

[0069] Utilize primer pgm-F2 / pgm-R2 to amplify and obtain the phosphoglucomutase gene pgm (SEQ ID NO.2) on the Genomic DNA of Cordyceps militaris, utilize -Uni Seamless Cloning and Assembly Kit linked the target gene fragment with the plasmid to obtain the recombinant vector PCAMBIA-PgpdA-pgm-Tcbh1-hph-PtrpC.

[0070] Table 5 Primers

[0071]

[0072]

[0073] Other operations are the same as in Example 1, obtain the recombinant Cordyceps militaris strain containing the gene pgm, take the extracted genomic DNA of the Cordyceps militaris hygromycin-resistant strain, and use HF-check / HR-check primers for PCR verification to check whether the transformation is successful , the result is as figure 2 Shown; Determination of total sugar content of transgenic strains, glucose...

Embodiment 3

[0074] Embodiment 3 contains the recombinant Cordyceps militaris strain of gene ugp

[0075] The extraction of Genomic DNA of Cordyceps militaris CGMCC 3.14242 is the same as in Example 1.

[0076] Utilize primer ugp-F3 / ugp-R3 to amplify and obtain the pyrophosphorylase gene ugp on the Genomic DNA of Cordyceps militaris, utilize -Uni Seamless Cloning and Assembly Kit Link the target gene fragment with the plasmid to obtain the recombinant vector PCAMBIA-PgpdA-ugp-Tcbh1-hph-PtrpC.

[0077] Table 6 Primers

[0078] ugp-F3 GCAGACATCACAATGGTTGTGGCAGGGGGGAGGAGGG ugp-R3 TTTCGCCACGGAGCTTAATGCTCAAGCAGGCGTAGCGAG Plasmid-F AGCTCCGTGGCGAAAGCCTGACGCA Plasmid-R CATTGTGATGTCTGCTCAAGCGGGGT HF-check CTATTCCTTTGCCCTCGGACGA HR-check ATGCCTGAACTCACCGCGACGT

[0079] Other operations are the same as in Example 1, obtain the recombinant Cordyceps militaris strain containing the gene ugp, take the extracted genomic DNA of the Cordyceps militaris hy...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving the content of cordyceps polysaccharide in cordyceps militaris. The method comprises the following steps of: inoculating cordyceps militaris recombinantbacteria containing a target gene into a fermentation culture medium, and carrying out shake cultivation at a temperature of 22-25 DEG C at 120-180 rpm to obtain fermentation liquor containing the cordyceps polysaccharide, wherein the target gene is a glucokinase gene gk, a glucophosphomutase gene psm or a pyrophosphorylase gene ugp. Through a transgenic technology, the gene mutation bacterial strain of the cordyceps militaris is obtained. Compared with an original bacterial strain, the mutation bacterial strain is characterized in that the yield of the cordyceps polysaccharide in the fermentation liquor of the mutation bacterial strain is 1.35 times, and a foundation is laid for further screening a good variety of the cordyceps militaris.

Description

[0001] (1) Technical field [0002] The invention relates to the field of Cordyceps militaris cultivation, in particular to a method for increasing the polysaccharide content of Cordyceps militaris. [0003] (2) Background technology [0004] As a traditional Chinese medicine, the research and application of Cordyceps has attracted much attention. Cordyceps is formed by the spores of Ascomycoa, Hypocreales, Clavicipitaceae, and Cordyceps fungi that parasitize on insect larvae and produce fruiting bodies from the insect body in summer. fungus complex. The most famous of these are Cordyceps militaris, which parasitizes the larvae of the alpine bat moth (Hepialus armoricanus), and Cordyceps militaris, which parasitizes the larvae of the alpine bat moth (Hepialus armoricanus). However, C.militaris is different from O.sinensis in that the fruiting body of C.militaris is easier to cultivate, and it is a model strain of Cordyceps, so it is often used by scientific research teams as ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/04C12N1/15C12N15/80C12R1/645
CPCC12P19/04C12N9/1205C12Y207/01002C12Y207/0101C12N1/14C12N15/80
Inventor 杨胜利杨锡陈萍季小康孔潇慧
Owner ZHEJIANG UNIV OF TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More