Application of LamG5 peptide in preparation of drug for repairing supporting cell injury in testis
A technology of Sertoli cells and testes, applied in the field of biochemistry, can solve problems such as Sertoli cell damage
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Cloning method of LamG5 coding gene fragment
[0027] Using SD rat testis cDNA, refer to the rat laminin α2 coding gene sequence XM_017590489.1 to design cloning primers
[0028] Upstream primer: CCGCTCGAGATGGTTGGATTGGACCTTCTTGTA (SEQ ID NO.3);
[0029] Downstream primer ACGCGTCGACTTACAGAGCCTTGGCAAAATTAAC (SEQ ID NO.4);
[0030] The primers include restriction endonuclease sites XhoI / SalI, start / stop codons and protective bases, and the LamG5 coding gene fragment is obtained after PCR amplification, which is detected by electrophoresis. The electrophoresis results are as follows figure 1 as shown, figure 1 It is the result of PCR amplification electrophoresis of LamG5 fragment. Depend on figure 1 It can be seen that the predicted length of the PCR product is 481bp, and the electrophoresis result is consistent with the predicted length of the product. It can be seen from this that the amplified PCR product conforms to the predicted length.
[0031] 2. Sequencing o...
Embodiment 2
[0037] Isolation and culture of primary Sertoli cells
[0038] A total of 10 20-day-old male SD rats were killed and their testes were collected. Remove testicular capsule, free seminiferous tubules, and cut to 1mm with scissors 3 , and then digested with trypsin, protease inhibitors, collagenase, hyaluronidase and other enzymes in turn. After the digested cell mass was pipetted with a glass Pasteur pipette, the density gradient centrifuged, and finally the precipitated cells were taken to measure the volume and converted into the number of cells. Finally, the cells were cultured in F12 / DMEM cell culture medium containing human transferrin (5 μg / ml), bovine insulin (10 μg / ml), bacitracin (5 μg / ml) and epithelial growth factor (2.5ng / ml).
Embodiment 3
[0040] Overexpression of LamG5 in Sertoli cells after PFOS exposure restores intercellular junctions
[0041] The Sertoli cells isolated in Example 2 can form a tight junction morphology similar to epithelial cells under in vitro culture conditions. Before inoculating the primary isolated Sertoli cells, Matrigel diluted in the culture solution was coated on the surface of the nitrocellulose membrane of the cell culture chamber, and then the Sertoli cells were inoculated, and after they were attached to the culture chamber, they were cultured with Millicell-ERS (Millipore ) The cell resistance detector detects its transmembrane resistance once a day. On the third day of Sertoli cell culture, PFOS was treated with a final concentration of 20 μM for a total of 24 hours. On the fourth day (24 hours after PFOS treatment), the medium was changed, and the LamG5 eukaryotic cell expression vector pCI-neo-LamG5 or the empty vector pCI-neo was transfected, and the transfection reagent w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More