Potato KNOX transcription factor StKNOX1 gene, encoded protein and application thereof
A technology for transcription factor and protein encoding, applied in the field of potato KNOX transcription factor StKNOX1 gene, encoding protein
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Cloning of Potato KNOX Transcription Factor StKNOX1 Gene
[0038] The present invention uses RT-PCR technology to isolate and clone the potato KNOX transcription factor StKNOX1 from the potato cultivar'Longshu 3'. The sequences of all primers are as follows:
[0039] TF: AGAGGTAATAAAAGATGCTT (SEQ ID NO. 2);
[0040] TR: TTAAAATGAATCTATAAATTA (SEQ ID NO. 3).
[0041] The specific cloning method is as follows: first extract the total RNA of potato leaves with the kit, see the instructions for the specific process, and then use the reverse transcription kit (purchased from Tiangen) to reverse transcription of the mRNA into total cDNA. This template uses TF and TR as primers for PCR amplification. The PCR amplification reaction program is: 95°C pre-denaturation for 5 minutes; 95°C denaturation for 30s, 50°C annealing for 30s, 72°C extension for 80s, 35 cycles; 72°C Finally extend for 10 minutes. The PCR amplification reaction system is: 25μL PCR amplification system contains 12.5...
Embodiment 2
[0044] Construction of Expression Vector of Potato KNOX Transcription Factor StKNOX1 Gene
[0045] Add NcoI / SpeI restriction sites on both sides of the primers of the StKNOX1 gene amplified in Example 1, and use the constructed pMD-18T vector as a template for PCR amplification, and clone the amplified product into pMD-18T Vector, the specific steps are the same as the cloning method in Example 1. After the positive strain is obtained, the plasmid DNA is advanced, and the plasmid DNA with the full length of the target gene is digested with NcoI / SpeI. At the same time, the plant expression vector pcambia1302 is digested with NcoI / SpeI. The respective digested products are subjected to 1% agarose gel. After electrophoresis, the target band was recovered with a gel recovery kit (purchased from Tiangen), and the target gene fragment and pcambia1302 vector fragment were mixed in a ratio of 1:2, and T4 DNA ligase (purchased from Promga) 1U, 1 ×Reaction buffer, sterile water supplement...
Embodiment 3
[0047] The recombinant plasmid prepared in Example 2 was transformed into Agrobacterium GV3101 by the heat shock transformation method, and the positive spots were screened with LB solid resistance plates containing 100 mg / L rifampicin (Rif) and 50 mg / L kana (Km). Pick several positive spots in LB liquid medium containing 100mg / L of rifampicin (Rif) and 50mg / L of kana (Km) and incubate overnight at 180r / min at 28°C, and take 1uL as a template for PCR of recombinant plasmids The strains confirmed to be positive are stored for subsequent genetic transformation.
[0048] 3. Genetic transformation of potato KNOX transcription factor StKNOX1 gene
[0049] Pick a single colony and inoculate it with 50mg·L -1 Kan's 50ml LB liquid medium was cultured in a constant temperature shaker at 28°C, 180rpm shaking for 24h, and then used for dip transformation. Cut the sterile tube potato into slices about 1 to 2 mm, and immerse in the Agrobacterium solution for 15 minutes. After taking it out, t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap