Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for rapidly detecting bordetella pertussis and detection method

A pertussis and kit technology, which is applied in the rapid detection of pertussis bacilli and its detection field, can solve the problems of low sensitivity of serological screening, cumbersome operation, long culture period, etc., to improve thermal stability, stability, The detection steps are simple and the effect of improving efficiency

Pending Publication Date: 2020-09-08
SHENZHEN YILIFANG BIOTECH CO LTD
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the more common clinical methods for pertussis diagnosis are culture method and serological screening, but it is difficult to isolate and culture pertussis bacilli, and the culture period is long, while serological screening has the defects of low sensitivity and low specificity, these factors Limit the clinical application of the above two detection methods of B. pertussis
Although molecular nucleic acid diagnostic technology has greatly accelerated clinical testing in recent years, the operation is still cumbersome and time-consuming in the process of sample processing
Moreover, the existing Bacillus pertussis nucleic acid detection technology requires cumbersome steps to extract the nucleic acid in the pathogen to meet the requirements of the PCR reaction system, and it needs to complete the preparation of multiple tubes during use, which is inconvenient to use
In addition, the existing Bacillus pertussis nucleic acid detection kits need to be kept strictly below -18°C
Its transportation relies on cold chain material transportation, and transportation costs and storage are inconvenient

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for rapidly detecting bordetella pertussis and detection method
  • Kit for rapidly detecting bordetella pertussis and detection method
  • Kit for rapidly detecting bordetella pertussis and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Design and preparation of primers and probes

[0030] Download all genome sequences of Bordetella hallii, B. parapertussis, and B. pertussis from Genebank, and find out the difference regions of the genomes of various pathogens through multiple alignments. And the stable conserved region of the published B. pertussis genome sequence is used as the target sequence for detection, and specific detection primers and probes are designed and synthesized for the target sequence.

[0031] 2. Screening of primers and probes

[0032] Multiple sets of primers and probes designed were used to detect the genomic DNA of positive and negative controls of various pathogen samples, and after repeated experiments, the combination of primers and probes with the best sensitivity, specificity and repeatability was screened out:

[0033] Upstream primer: 5' ATGCGCGTCAACTGCGCGCCTTGTTGACGCGACGCG 3'

[0034] Downstream primer: 5' GCGATGGCCTTGTCGATGGAACCATCGACCAAG 3'

[0035] The probe seq...

Embodiment 2

[0049] 1. Evaluation of kit detection sensitivity

[0050] Take an appropriate amount of Bacillus pertussis bacterial liquid obtained by isolation and culture, inactivate the bacterial liquid and use turbidimetric method to measure the number of bacteria, and then dilute it successively to 10 times by 10-fold gradient dilution method. 7 、10 6 、10 5 、104 、10 3 、10 2 For bacterial suspensions on the order of CFU / mL, directly add the above samples to the amplification system for detection.

[0051] The evaluation result shows that the minimum detection limit of the kit provided by the invention to B. pertussis is 10 2 CFU / mL.

[0052] 2. Evaluation of kit detection specificity

[0053] In order to evaluate the detection specificity of the kit provided by the invention, a group of common respiratory pathogens, such as influenza A virus, influenza B virus, respiratory syncytial virus, Epstein-Barr virus, Haemophilus influenzae, were screened in the experiment from clinical s...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for rapidly detecting bordetella pertussis and a detection method thereof. A specific probe is combined with a high-tolerance polymerase technology, a sample can be directly amplified after simple heating treatment, a nucleic acid extraction step is not needed, and the sample treatment time of a pertussis sample is shortened. The components used for detecting bordetella pertussis are prepared into a dry powder preparation, so that the thermal stability of the kit is remarkably improved, and the kit can be used for normal-temperature transportation. The single-tubepackaging of the multi-component dry powder reduces the step of liquid preparation. Experimental results prove that the kit and the detection method thereof are strong in specificity, high in sensitivity and simple to operate, and can be used for directly, quickly and accurately detecting the bordetella pertussis.

Description

technical field [0001] The invention relates to the technical field of pathogenic nucleic acid detection, in particular to a kit for rapidly detecting pertussis bacillus and a detection method thereof. Background technique [0002] pertussis ( Bordetella Pertussis , BP) is the pathogenic bacterium of whooping cough. The incubation period of whooping cough is 1-2 weeks. In the early stage of onset (catarrhal stage), there is only mild cough. At this time, the bacteria multiply on the mucous membrane of the trachea and bronchi and are discharged with droplets, which is the most contagious. . Paroxysmal spasmodic cough (spasmodic cough period) occurs after 1 to 2 weeks. At this time, the bacteria release toxins, causing the cilia of the mucosal epithelial cells to lose control, and a large amount of viscous secretions cannot be discharged, which stimulates the receptors in the mucosa to produce a strong spasmodic cough. It presents a special high-pitched cock-crow-like roar, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6851C12Q1/06C12N15/11C12R1/01
CPCC12Q1/6851C12Q1/689C12Q2531/113C12Q2563/107
Inventor 廖生赟
Owner SHENZHEN YILIFANG BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products