A kind of pcr primer, probe and identification method of appv virus
A primer probe and virus technology, applied in the field of APPV virus identification, can solve the problems of low sensitivity and high sensitivity of PCR detection, and achieve the effect of high sensitivity, good specificity and rapid detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] A droplet digital PCR method for identifying APPV virus, the primer sequences used in the method are: APPV-F: GTCAATAAGTTCCTCCACCAAGTCGT (SEQ. ID NO 1); APPV-R: ACCTGAAAGGGTGGTCCGG (SEQ. ID NO 2), which is based on The APPV NS5A gene in GenBank was designed; the used probe sequence was: APPV-P: ACGCCGATTTGATTCTC (SEQ. ID NO 3), the 5' end of the probe was labeled with FAM, and the 3' end was labeled with MGB.
[0023] The droplet digital PCR reaction system used in this method is: ddPCRTM Supermix for Probes (nodUTP) 10 μL, probe 0.5 μL, upstream and downstream primers 1 μL each, cDNA (template) of the sample to be detected 2 μL, and the final volume is 20 μL with water. The microdroplet digital PCR reaction program was: 95°C for 10 min; 94°C for 30 s, 52.7°C for 60 s, a total of 40 cycles; 98°C for 10 min.
[0024] If the sample to be tested has a positive droplet with a fluorescent signal, it contains APPV virus.
experiment example 1
[0025] Experimental example 1 Optimization of droplet digital PCR (ddPCR) reaction system
[0026] 1. Preparation of APPV recombinant plasmid standard
[0027] The total RNA of swine atypical fever virus-positive disease materials was extracted by Trizol method. Perform reverse transcription according to the instructions of the Prime Script reverse transcription kit to obtain cDNA, and amplify the obtained cDNA with the above primers. Whether the size is consistent with the expected band (113bp), the amplification product is preliminarily verified.
[0028] The above PCR products were recovered and purified using a gel recovery kit, and the recovered products were ligated with pMD19-T SimpleVector overnight, and the recombinant plasmids were transformed into DH5α competent cells.
[0029] Use a plasmid DNA extraction kit to extract the plasmid to identify whether it is positive, sequence the positive recombinant plasmid, and compare the sequencing results on the NCBI website...
experiment example 2
[0044] Experimental Example 2 Specificity test
[0045] The APPV ddPCR detection method established in this study was used to detect APPV and five other (CSFV, JEV, PCV-2, PCV-3, PRV) positive samples, and a negative control was established.
[0046] APPV, CSFV, JEV, PCV-2, PCV-3, PRV and other related viral nucleic acids were detected by the established APPV ddPCR detection method. The results are shown in Figure 5 (1: CSFV; 2: JEV; 3: PCV-2; 4: APPV; 5: PCV-3; 6: PRV), except that APPV had obvious positive droplets with fluorescent signal, the others were negative, indicating that The established APPV ddPCR detection method has good specificity.
[0047] Experimental Example 3 Sensitivity test
[0048] The serially diluted template was subjected to ddPCR, and three parallel replicates were set for each concentration gradient, and a negative control was set up. The final result was the average of the three replicate samples for sensitivity analysis.
[0049] APPV ddPCR an...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More