Hypersensitive molecular lock and key immune polymerase chain reaction detection method
A chain reaction and detection method technology, applied in the field of medical laboratory science, can solve the problems of contaminated negative samples, false positive results, etc., and achieve the effects of high sensitivity detection, sensitivity improvement, and high use value
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0032] Antigens of Mycobacterium tuberculosis were tested in blood samples, ascites, and cerebrospinal fluid using a hypersensitive molecular lock-key immunopolymerase chain reaction assay.
[0033] (1) Prepare experimental components and experimental equipment
[0034] (1) Components required for making experiments:
[0035] ① Preparation of recombinant Mycobacterium tuberculosis early secretion antigen target protein 6 (ESAT6) reference product, culture filtrate egg 10 (CFP10) reference product, PstS1 protein reference product: the genes of ESAT6 reference product, CFP10 reference product and PstS1 protein reference product The sequence was cloned into Escherichia coli expression vector PET28a;
[0036] Among them, the gene sequence of ESAT6:
[0037]ATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGGGAAGCAGTCCCTGACCAAGCTCGCAGCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGGACGA...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


