Primer group for identifying avian nephritis virus and chicken infectivity anemia virus and application thereof
A technology of chicken infectious anemia and primer set, applied in the field of primer sets for identification of poultry nephritis virus and chicken infectious anemia virus
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1. Primer design
[0028] After a large number of sequence analysis and comparison, several primers used to identify avian nephritis virus and several primers used to identify chicken infectious anemia virus were obtained. Perform preliminary experiments on each primer, compare the sensitivity and specificity, and finally obtain primer pair I and primer pair II for identifying avian nephritis virus and chicken infectious anemia virus. The primer combination consists of primer pair I and primer pair II. .
[0029] ANV-F (SEQ.ID.NO.1): GACTGGATAAGCGTGTTAGGA;
[0030] ANV-R (SEQ.ID.NO.2): TATCATCTCCGTAGCAAAGAA;
[0031] CIAV-F (SEQ.ID.NO.3): ACCACTACTCCCAGCCGACCC;
[0032] CIAV-R (SEQ.ID.NO.4): CGTACCGGGGCGGGGGTTGTG.
Embodiment 2
[0033] Example 2. Optimization of double PCR reaction conditions
[0034] 1. Template preparation
[0035] 1. Extract the genomic DNA of avian nephritis virus to obtain sample A.
[0036] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.
[0037] 3. Mix sample A and sample B to obtain a mixed sample.
[0038] 2. Optimization of primer concentration
[0039] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR. Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, the mixed sample obtained in step 1 is 2.0μL (in the 2.0μL mixed sample, the content of the genomic cDNA of the avian nephritis virus is 1.0ng, chicken infectious anemia The content of virus DNA is 1.0ng), primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL. According to the concentration of the primer pair in the reaction system, different reaction systems are designed, as shown in Table 1:
[0...
Embodiment 3
[0057] Example 3. Specificity
[0058] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken infectious anemia virus (CIAV), avian adenovirus type 4 (FadV-4), chicken parvovirus (ChPV), Marek virus (MDV), subtype J avian leukemia virus (ALV-J) , Infectious laryngotracheitis virus (ILTV).
[0059] 2. Extract the total RNA of the sample to be tested and reverse transcribed into cDNA. The samples to be tested are: Avian nephritis virus (ANV), Chicken Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).
[0060] 3. Using each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of Example 2 as templates, the primer combination prepared in Example 1 is used to perform double PCR.
[0061] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, template 2.0μL, primer pair I and primer pair II, and finally ddH 2 Make up O ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



