Supercharge Your Innovation With Domain-Expert AI Agents!

Primer group for identifying avian nephritis virus and chicken infectivity anemia virus and application thereof

A technology of chicken infectious anemia and primer set, applied in the field of primer sets for identification of poultry nephritis virus and chicken infectious anemia virus

Pending Publication Date: 2020-10-02
GUANGXI VETERINARY RES INST
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Compared with conventional PCR, multiplex PCR has the characteristics of simultaneous detection and identification of multiple pathogens, and has unique advantages and high clinical practical value in the differential diagnosis of mixed infections of various pathogens. However, there is no rapid differential diagnosis at present. Multiplex PCR detection method for ANV and CIAV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for identifying avian nephritis virus and chicken infectivity anemia virus and application thereof
  • Primer group for identifying avian nephritis virus and chicken infectivity anemia virus and application thereof
  • Primer group for identifying avian nephritis virus and chicken infectivity anemia virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1. Primer design

[0028] After a large number of sequence analysis and comparison, several primers used to identify avian nephritis virus and several primers used to identify chicken infectious anemia virus were obtained. Perform preliminary experiments on each primer, compare the sensitivity and specificity, and finally obtain primer pair I and primer pair II for identifying avian nephritis virus and chicken infectious anemia virus. The primer combination consists of primer pair I and primer pair II. .

[0029] ANV-F (SEQ.ID.NO.1): GACTGGATAAGCGTGTTAGGA;

[0030] ANV-R (SEQ.ID.NO.2): TATCATCTCCGTAGCAAAGAA;

[0031] CIAV-F (SEQ.ID.NO.3): ACCACTACTCCCAGCCGACCC;

[0032] CIAV-R (SEQ.ID.NO.4): CGTACCGGGGCGGGGGTTGTG.

Embodiment 2

[0033] Example 2. Optimization of double PCR reaction conditions

[0034] 1. Template preparation

[0035] 1. Extract the genomic DNA of avian nephritis virus to obtain sample A.

[0036] 2. Extract the DNA of chicken infectious anemia virus to obtain sample B.

[0037] 3. Mix sample A and sample B to obtain a mixed sample.

[0038] 2. Optimization of primer concentration

[0039] Take the mixed sample obtained in step 1 as a template, and use the primer combination prepared in Example 1 to perform double PCR. Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, the mixed sample obtained in step 1 is 2.0μL (in the 2.0μL mixed sample, the content of the genomic cDNA of the avian nephritis virus is 1.0ng, chicken infectious anemia The content of virus DNA is 1.0ng), primer pair I and primer pair II, and finally ddH 2 Make up O to 25.0 μL. According to the concentration of the primer pair in the reaction system, different reaction systems are designed, as shown in Table 1:

[0...

Embodiment 3

[0057] Example 3. Specificity

[0058] 1. Extract the genomic DNA of the sample to be tested. The samples to be tested are: chicken infectious anemia virus (CIAV), avian adenovirus type 4 (FadV-4), chicken parvovirus (ChPV), Marek virus (MDV), subtype J avian leukemia virus (ALV-J) , Infectious laryngotracheitis virus (ILTV).

[0059] 2. Extract the total RNA of the sample to be tested and reverse transcribed into cDNA. The samples to be tested are: Avian nephritis virus (ANV), Chicken Newcastle disease virus (NDV), H9 subtype avian influenza virus (AIV-H9), and infectious bronchitis virus (IBV).

[0060] 3. Using each genomic DNA sample obtained in step 1, each cDNA sample obtained in step 2, and the mixed sample obtained in step 1 of Example 2 as templates, the primer combination prepared in Example 1 is used to perform double PCR.

[0061] Double PCR reaction system (25.0μL): contains 2×PCR Mix 12.5μL, template 2.0μL, primer pair I and primer pair II, and finally ddH 2 Make up O ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer group for identifying avian nephritis virus and chicken infectivity anemia virus. The primer group comprises a primer pair I and a primer pair II, wherein the primer pair I is composed of primers ANV-F and ANV-R, and the primer pair II is composed of primers CIAV-F and CIAV-R; the primers ANV-F, ANV-R, CIAV-F and CIAV-R have base sequences from SEQ. ID. NO.1 to SEQ. ID. NO.4 in the sequence table respectively. Therefore, the inventor also establishes a corresponding detection and identification method and develops a corresponding test kit. The duplex PCR established by the invention can be used for rapidly detecting mixed infection of avian nephritis virus and chicken infectivity anemia virus, is suitable for large-batch detection, can save cost and time, can reduce pollution, and has very high practical value.

Description

Technical field [0001] The invention belongs to the technical field of detection of avian nephritis virus and avian infectious anemia virus, and particularly relates to a primer set for identifying avian nephritis virus and avian infectious anemia virus and its application. Background technique [0002] Avian Nephritis Virus (ANV) is an enteric virus that mainly infects chickens and can be infected at all ages, but it mainly attacks chicks and can be detected in turkeys, ducks and pigeons. The virus mainly causes a typical sub-clinical symptom. Although it is not very pathogenic, it is highly infectious and can spread rapidly among chickens. It was first discovered in Japan in 1976, and subsequently occurred in other countries. In all parts of the world, it can be severely manifested as enteritis, kidney damage and growth dysplasia, etc., which are related to chicken dwarf syndrome. Chicken infectious anemia is an infectious disease caused by chicken infectious anemia virus (CIA...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11C12R1/93
CPCC12Q1/701C12Q1/686C12Q2600/16C12Q2537/143C12Q2565/125
Inventor 谢芝勋张艳芳邓显文刘加波谢志勤张民秀谢丽基罗思思曾婷婷
Owner GUANGXI VETERINARY RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More