Unlock instant, AI-driven research and patent intelligence for your innovation.

Preparation method of single-stranded circular DNA

A single-stranded, circular technology, applied in the field of nucleic acids, can solve the problems of low connection efficiency, difficult to open, difficult to prepare single-stranded DNA, etc., and achieve the effect of improving yield and wide application range.

Active Publication Date: 2020-10-20
OCEAN UNIV OF CHINA
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The present invention aims at the problem that in the traditional medium-length single-circle DNA preparation process, the medium-length single-stranded DNA as an important raw material is difficult to prepare, and the constant temperature connection is difficult to open the complex secondary structure of the single strand, resulting in low connection efficiency. A method for the preparation of stranded circular DNA, using medium-length double-stranded DNA as a raw material, and adopting a double-strand variable temperature cycle ligation reaction to efficiently prepare medium-length single-circle DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of single-stranded circular DNA
  • Preparation method of single-stranded circular DNA
  • Preparation method of single-stranded circular DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] 1) Raw materials

[0035] aPCR primer chain F (358EX-F) (5'→3'): GTCTTGAGTCCAACCCGG (18nt in length, SEQ ID NO: 1)

[0036] aPCR primer chain R (358EX-R) (5'→3'): ATGACCAAAATCCCTTAACG (5'-phosphorylated, 20nt in length, SEQ ID NO: 2)

[0037] splint(5'→3'): CGTTAAGGGATTTTGGTCATGTCTTGAGTCCAACCCGGTA (40nt in length, SEQ ID NO: 3)

[0038] Template source: Escherichia coli plasmid pUC18 (Thermo Fisher Scientific Biotechnology Co., Ltd.)

[0039] 2) Preparation of medium-length single-stranded and double-stranded DNA

[0040] Asymmetric PCR (aPCR) was used to prepare 358nt single-stranded DNA, and PCR was used to prepare 358bp double-stranded DNA. The PCR system is: [pUC 18]=2×104copies / μL, [358EX-F]=0.2μM, [358EX-R]=0.2μM, [Phanta MaxMaster Mix]=1×, total volume 20μL; 95℃ pre-denaturation 5min, denaturation at 95°C for 15s, annealing at 55°C for 15s, extension at 72°C for 30s, 38 cycles, and finally extension at 72°C for 10min. aPCR system: PCR product (diluted 100 ti...

Embodiment 2

[0054] 1) Raw material

[0055] aPCR primer chain F (358EX-F) (5'→3'): GTCTTGAGTCCAACCCGG (18nt in length, SEQ ID NO: 1)

[0056] aPCR primer chain R (358EX-R) (5'→3'): ATGACCAAAATCCCTTAACG (5'-phosphorylated, 20nt in length, SEQ ID NO: 2)

[0057] splint(5'→3'):

[0058] 358B-S-20: CGTTAAGGGATTTTGGTCATGTCTTGAGTCCAACCCGGTA (40 nt, SEQ ID NO: 3)

[0059] 358B-S-25: ACTCACGTTAAGGGATTTTGGTCATGTCTTGAGTCCAACCCGGTAAGACA (50 nt, SEQ ID NO: 4)

[0060] 358B-S-30:

[0061] CGAAAACTCACGTTAAGGGATTTTGGTCATGTCTTGAGTCCAACCCGGTAAGACAC GAC (59nt, SEQ ID NO: 5)

[0062] Template source: Escherichia coli plasmid pUC18 (Thermo Fisher Scientific Biotechnology Co., Ltd.)

[0063] 2) Preparation of medium-length double-stranded DNA

[0064] 358nt double-stranded DNA was prepared by PCR. PCR system: [pUC 18]=2×104copies / μL, [358EX-F]=0.2 μM, [358EX-R]=0.2 μM, [Phanta Max Master Mix]=1×, total volume 20μL; pre-denaturation at 95°C 5min, denaturation at 95°C for 15s, annealing at 55°C for 15s,...

Embodiment 3

[0072] 1) Raw material

[0073] aPCR primer chain F (358EX-F) (5'→3'): GTCTTGAGTCCAACCCGG (18nt in length, SEQ ID NO: 1)

[0074] aPCR primer chain R (358EX-R) (5'→3'): ATGACCAAAATCCCTTAACG (5'-phosphorylated, 20nt in length, SEQ ID NO: 2)

[0075] splint(5'→3'):

[0076] 358B-S-20: CGTTAAGGGATTTTGGTCATGTCTTGAGTCCAACCCGGTA (40 nt, SEQ ID NO: 3)

[0077] Template source: Escherichia coli plasmid pUC18 (Thermo Fisher Scientific Biotechnology Co., Ltd.)

[0078] 2) Preparation of medium-length double strands

[0079] A 358bp double strand was prepared by PCR. PCR system: [pUC 18]=2×104copies / μL, [358EX-F]=0.2μM, [358EX-R]=0.2μM, [PhantaMax Master Mix]=1×, total volume 20μL; pre-denaturation at 95°C for 5min , Denaturation at 95°C for 15s, annealing at 55°C for 15s, extension at 72°C for 30s, 38 cycles, and finally extension at 72°C for 10min. Before the ligation reaction, the PCR product (monophosphorylated DNA double strand) was extracted to remove the PCR polymerase in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of nucleic acid, and relates to a preparation method of single-stranded circular DNA. The method comprises the following steps: preparing medium-length monophosphorylated double-stranded DNA with a phosphate group at the 5'end of one strand through PCR, mixing medium-length monophosphorylated double-stranded DNA required by cyclization reaction with template DNA assisting cyclization according to a certain proportion, adding heat-resistant ligase and a reaction buffer solution, mixing to prepare a ligation reaction system, and performing multiple cycles of high-temperature denaturation and cooling ligation to prepare a double-stranded product with only one chain cyclization; and purifying and separating the cyclized single-stranded circular DNAfrom the DNA, and carrying out electrophoresis detection. According to the method, single-stranded DNA does not need to be prepared, the medium-length double-stranded DNA is directly used as a raw material, and medium-length monocyclic DNA is efficiently prepared by adopting a double-stranded variable-temperature cyclic connection reaction; and the complex secondary structure of the medium-lengthdouble-stranded DNA can be opened through enzyme method connection ring formation, and the yield of the medium-length single-stranded circular DNA is increased.

Description

technical field [0001] The invention belongs to the technical field of nucleic acids, and in particular relates to a method for preparing single-stranded circular DNA. Background technique [0002] Single-stranded circular DNA is a circular structure formed by connecting single-stranded DNA end to end. It has the characteristics of strong stability and flexibility, no free ends, and is not easily degraded by common nucleases. Single-stranded circular DNA Shaped DNA has gradually become an important element in the construction of advanced nanostructures such as DNA origami and molecular machines. In addition, single-stranded circular DNA can also be used in food, biology, medicine and other fields; in the field of molecular biology, single-stranded circular DNA can be used as a template for rolling circle amplification and transcription; in the field of detection, circular G-tetramer and DNAzyme are designed on molecular machines to detect ions and other substances in sample...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/10
CPCC12N15/10C12Q2531/113C12Q2521/325C12Q2521/501C12Q2525/113
Inventor 梁兴国刘梦琴王伟男隋哲安然
Owner OCEAN UNIV OF CHINA